cd99l2基因调控斑马鱼白细胞组织间的迁移机制

doi:10.16288/j.yczz.22-193

[an error occurred while processing this directive]

Hereditas(Beijing) ›› 2022, Vol. 44 ›› Issue (9): 798-809.doi: 10.16288/j.yczz.22-193

• Research Article • Previous Articles Next Articles

The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish

Jing’ao Lu^1,²(), Chunyan Huang^1,², Zhiyin Lin^1,², Zheng Tang^1,², Ning Ma^1,²(), Zhibin Huang³()

1. Department of Histology and Embryology, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, China
2. NMPA Key Laboratory for Safety Evaluation of Cosmetics, Southern Medical University, Guangzhou 510515, China
3. Division of Development Biology & Regenerative Medicine, South China University of Technology, Guangzhou 510006, China;

Received:2022-06-13 Revised:2022-08-17 Online:2022-09-20 Published:2022-08-19
Contact: Ma Ning,Huang Zhibin E-mail:18609668060@163.com;mn1228@smu.edu.cn;huangzhb1986@scut.edu.cn
Supported by:
Supported by the National Key Research and Development Program of China(2018YFA0801000);the National Natural Science Foundation of China No(31401231)

Abstract

Abstract:

Leukocytes play an essential role in ontogeny, tissue regeneration, and innate and adaptive immunity. The migration of leukocytes to the infected or traumatized areas is necessary for their immune response function. As an adhesion molecule, CD99L2 is crucial in the extravasation of leukocytes, however, its role in the interstitial migration of leukocytes remains unclear. In this study, the cd99l2 gene was knock-out by TALEN (transcription activator-like effector nuclease) in zebrafish and discovered that the deletion had no effect on zebrafish development. The number of granulocytes and macrophages recruited to the wounded tissue was significantly reduced in the cd99l2 mutants following caudal fin damage. Further research revealed that the expression of mfap4 was drastically decreased in the cd99l2 mutants, which may be one of the reasons that affect the migration of macrophages to the wound site. Moreover,transgenic lines with labeled vasculature, neutrophils and macrophages demonstrated that neutrophils and macrophages migrate throughout the interstitial space to the wound tissue in both wild-type and mutant zebrafish at 60 hours post-fertilization, indicating that the cd99l2 gene is involved in the interstitial migration of leukocytes. Finally, RNA transcription, protein folding, and the P450 pathway were enriched in cd99l2 mutants by RNA-seq analysis. Previous research had demonstrated that the regulation of transcription and signal transduction could be affected by adhesion molecules, which may suggest that the cd99l2 gene is involved in the cascade signaling pathway of leukocyte migration as an adhesion molecule. In conclusion, this study uncovered a novel function of the cd99l2 gene in the process of leukocyte migration in zebrafish, which is expected to provide a theoretical foundation for inflammatory and immune-related diseases.

Key words: zebrafish cd99l2 gene, leukocyte migration, mfap4 gene, cascade signaling pathway

Jing’ao Lu, Chunyan Huang, Zhiyin Lin, Zheng Tang, Ning Ma, Zhibin Huang. The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish[J]. Hereditas(Beijing), 2022, 44(9): 798-809.

Figures/Tables 5

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 54

[1]	Silvestre-Roig C, Fridlender ZG, Glogauer M, Scapini P . Neutrophil diversity in health and disease. Trend Immunol, 2019,40(7):565-583.
[2]	Zabel BA, Rott A, Butcher EC . Leukocyte chemoattractant receptors in human disease pathogenesis. Annu Rev Pathol, 2015,10(1):51-81.
[3]	Nourshargh S, Alon R . Leukocyte migration into inflamed tissues. Immunity, 2014,41(5):694-707.
[4]	Kameritsch P, Renkawitz J . Principles of leukocyte migration strategies. Trends Cell Biol, 2020,30(10):818-832.
[5]	Alon R, Shulman Z . Chemokine triggered integrin activation and actin remodeling events guiding lymphocyte migration across vascular barriers. Exp Cell Res, 2011,317(5):632-641.
[6]	Ley K, Laudanna C, Cybulsky MI, Nourshargh S . Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol, 2007,7(9):678-689.
[7]	Mihlan M, Glaser KM, Epple MW, Lämmermann T . Neutrophils: amoeboid migration and swarming dynamics in tissues. Front Cell Dev Biol, 2022,10(3389):871789.
[8]	Wolf K, Müller R, Borgmann S, Bröcker EB, Friedl P . Amoeboid shape change and contact guidance: T-lymphocyte crawling through fibrillar collagen is independent of matrix remodeling by MMPs and other proteases. Blood, 2003,102(9):3262-3269.
[9]	Lämmermann T, Bader BL, Monkley SJ, Worbs T, Wedlich-Söldner R, Hirsch K, Keller M, Förster R, Critchley DR, Fässler R, Sixt M . Rapid leukocyte migration by integrin-independent flowing and squeezing. Nature, 2008,453(7191):51-55.
[10]	Friedl P, Weigelin B . Interstitial leukocyte migration and immune function. Nat Immunol, 2008,9(9):960-969.
[11]	Smith CW . 3. Adhesion molecules and receptors. J Allergy Clin Immunol, 2008, 121(2 Suppl): S375-379; quiz S414.
[12]	Jung U, Bullard DC, Tedder TF, Ley K . Velocity differences between L- and P-selectin-dependent neutrophil rolling in venules of mouse cremaster muscle in vivo. Am J Physiol, 1996,271(6 Pt 2):H2740-H2747.
[13]	Rose DM, Alon R, Ginsberg MH . Integrin modulation and signaling in leukocyte adhesion and migration. ImmunolRev, 2007,218(1):126-134.
[14]	Luo BH, Carman CV, Springer TA . Structural basis of integrin regulation and signaling. Annu Rev Immunol, 2007,25:619-647.
[15]	Schenkel AR, Mamdouh Z, Chen X, Liebman RM, Muller WA . CD99 plays a major role in the migration of monocytes through endothelial junctions. Nat Immunol, 2002,3(2):143-150.
[16]	Bixel G, Kloep S, Butz S, Petri B, Engelhardt B, Vestweber D . Mouse CD99 participates in T-cell recruitment into inflamed skin. Blood, 2004,104(10):3205-3213.
[17]	Muller WA . The role of PECAM-1 (CD31) in leukocyte emigration: studies in vitro and in vivo. J Leukoc Biol, 1995,57(4):523-528.
[18]	Liao F, Ali J, Greene T, Muller WA . Soluble domain 1 of platelet-endothelial cell adhesion molecule (PECAM) is sufficient to block transendothelial migration in vitro and in vivo. J Exp Med, 1997,185(7):1349-1357.
[19]	Zhou FC, Elzi DJ, Jayabal P, Ma XY, Chiu YC, Chen YD, Blackman B, Weintraub ST, Houghton PJ, Shiio Y . GDF6-CD99 signaling regulates src and ewing sarcoma growth. Cell Rep, 2020,33(5):108332.
[20]	Ali A, Vaikari VP, Alachkar H . CD99 in malignant hematopoiesis. Exp Hematol, 2022,106:40-46.
[21]	Huijbers EJM, van der Werf IM, Faber LD, Sialino LD, van der Laan P, Holland HA, Cimpean AM, Thijssen V, van Beijnum JR, Griffioen AW . Targeting tumor vascular CD99 inhibits tumor growth. Front Immunol, 2019,10:651.
[22]	Cardoso LC, Soares RDS, Laurentino TS, Lerario AM, Marie SKN, Oba-Shinjo SM . CD99 expression in glioblastoma molecular subtypes and role in migration and invasion. Int J Mol Sci, 2019,20(5):
[23]	Laopajon W, Pata S, Takheaw N, Surinkaew S, Khummuang S, Kasinrerk W . Triggering of CD99 on monocytes by a specific monoclonal antibody regulates T cell activation. Cell Immunol, 2019,335:51-58.
[24]	Schenkel AR, Dufour EM, Chew TW, Sorg E, Muller WA . The murine CD99-related molecule CD99-like 2 (CD99L2) is an adhesion molecule involved in the inflammatory response. Cell Commun Adhes, 2007,14(5):227-237.
[25]	Suh YH, Shin YK, Kook MC, Oh KI, Park WS, Kim SH, Lee IS, Park HJ, Huh TL, Park SH . Cloning, genomic organization, alternative transcripts and expression analysis of CD99L2, a novel paralog of human CD99, and identification of evolutionary conserved motifs. Gene, 2003,307:63-76.
[26]	Samus M, Seelige R, Schäfer K, Sorokin L, Vestweber D . CD99L2 deficiency inhibits leukocyte entry into the central nervous system and ameliorates neuroinflammation. J Leukoc Biol, 2018,104(4):787-797.
[27]	Seelige R, Natsch C, März S, Jing D, Frye M, Butz S, Vestweber D . Cutting edge: Endothelial-specific gene ablation of CD99L2 impairs leukocyte extravasation in vivo. J Immunol, 2013,190(3):892-896.
[28]	Hall C, Flores MV, Storm T, Crosier K, Crosier P . The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev Biol, 2007,7:42.
[29]	Yu T, Guo WL, Tian Y, Xu J, Chen JH, Li L, Wen ZL . Distinct regulatory networks control the development of macrophages of different origins in zebrafish. Blood, 2017,129(4):509-519.
[30]	Lawson ND, Weinstein BM . In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev Biol, 2002,248(2):307-318.
[31]	Westerfield. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). 4th ed. University of Oregon Press, Eugene, 2000.
[32]	Thisse C, Thisse B . High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat Protoc, 2008,3(1):59-69.
[33]	Chen SF, Zhou YQ, Chen YR, Gu J . Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics, 2018,34(17):i884-i890.
[34]	Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR . STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 2013,29(1):15-21.
[35]	Liao Y, Smyth GK, Shi W . FeatureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics, 2014,30(7):923-930.
[36]	Love MI, Huber W, Anders S . Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol, 2014,15(12):550.
[37]	Ito K, Murphy D . Application of ggplot2 to pharmacometric graphics. CPT Pharmacometrics Syst Pharmacol, 2013,2(10):e79.
[38]	Yu GC, Wang LG, Han YY, He QY . ClusterProfiler: an R package for comparing biological themes among gene clusters. OMICS, 2012,16(5):284-287.
[39]	Rutledge NS, Weber EW, Winger R, Tourtellotte WG, Park SH, Muller WA . CD99-like 2 (CD99L2)-deficient mice are defective in the acute inflammatory response. Exp Mol Pathol, 2015,99(3):455-459.
[40]	Le Guyader D, Redd MJ, Colucci-Guyon E, Murayama E, Kissa K, Briolat V, Mordelet E, Zapata A, Shinomiya H, Herbomel P . Origins and unconventional behavior of neutrophils in developing zebrafish. Blood, 2008,111(1):132-141.
[41]	Zakrzewska A, Cui C, Stockhammer OW, Benard EL, Spaink HP, Meijer AH . Macrophage-specific gene functions in Spi1-directed innate immunity. Blood, 2010,116(3):e1-e11.
[42]	Schlosser A, Thomsen T, Shipley JM, Hein PW, Brasch F, Tornøe I, Nielsen O, Skjødt K, Palaniyar N, Steinhilber W, McCormack FX, Holmskov U . Microfibril-associated protein 4 binds to surfactant protein A (SP-A) and colocalizes with SP-A in the extracellular matrix of the lung. Scand J Immunol, 2006,64(2):104-116.
[43]	Ruoslahti E . RGD and other recognition sequences for integrins. Annu Rev Cell Dev Biol, 1996,12:697-715.
[44]	Ong SLM, de Vos IJHM, Meroshini M, Poobalan Y, Dunn NR . Microfibril-associated glycoprotein 4 (Mfap4) regulates haematopoiesis in zebrafish. Sci Rep, 2020,10(1):11801.
[45]	Li L, Yan B, Shi YQ, Zhang WQ, Wen ZL . Live imaging reveals differing roles of macrophages and neutrophils during zebrafish tail fin regeneration. J Biol Chem, 2012,287(30):25353-25360.
[46]	Mauro VP, Wood IC, Krushel L, Crossin KL, Edelman GM . Cell adhesion alters gene transcription in chicken embryo brain cells and mouse embryonal carcinoma cells. Proc Natl Acad Sci USA, 1994,91(7), 2868-2872.
[47]	Kiser DP, Popp S, Schmitt-Böhrer AG, Strekalova T, van den Hove DL, Lesch KP, Rivero O. Early-life stress impairs developmental programming in Cadherin 13 (CDH13)-deficient mice. Prog Neuropsychopharmacol Biol Psychiatry, 2019,89:158-168.
[48]	Pober JS, Sessa WC . Evolving functions of endothelial cells in inflammation. Nat Rev Immunol, 2007,7(10):803-815.
[49]	Martin MU, Wesche H . Summary and comparison of the signaling mechanisms of the Toll/interleukin-1 receptor family. Biochim Biophys Acta, 2002,1592(3):265-280.
[50]	Christmas P . Role of cytochrome P450s in inflammation. Adv Pharmacol, 2015,74:163-192.
[51]	Aitken AE, Morgan ET . Gene-specific effects of inflammatory cytokines on cytochrome P450 2C, 2B6 and 3A4 mRNA levels in human hepatocytes. Drug Metab Dispos, 2007,35(9):1687-1693.
[52]	Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen JM, Hu ZC, Zalocusky KA, Shankar RD, Shen-Orr SS, Thomson E, Wiser J, Butte AJ . ImmPort, toward repurposing of open access immunological assay data for translational and clinical research. Sci Data, 2018,5:180015.
[53]	Ru BB, Wong CN, Tong Y, Zhong JY, Zhong SSW, Wu WC, Chu KC, Wong CY, Lau CY, Chen I, Chan NW, Zhang J . TISIDB: an integrated repository portal for tumor-immune system interactions. Bioinformatics, 2019,35(20):4200-4202.
[54]	Breuer K, Foroushani AK, Laird MR, Chen C, Sribnaia A, Lo R, Winsor GL, Hancock REW, Brinkman FSL, Lynn DJ . InnateDB: systems biology of innate immunity and beyond--recent updates and continuing curation. Nucleic Acids Res, 2013,41(Database issue):D1228-D1233.

Metrics

Comments

www.chinagene.cn
备案号：京ICP备09063187号

基因名称	引物序列(5′→3′)
ef1a	F: TACTTCTCAGGCTGACTGTG
ef1a	R: ATCTTCTTGATGTATGCGCT-3
cd99l2	F: CTACGACACCATGGCTGAGACT
cd99l2	R: CTTGTGGCTCCTGTGCGACTAC
lyz	F: AAAGCAGGTTTAAGACCCAC
lyz	R: CCAGGTTTCCCATGATTTCAG
mpx	F: AGAGACTGATAGAGATTCCATCC
mpx	R: CCAGGTTTCCCATGATTTCAG
mfap4	F: GTTTACACCATCTATCCAGCC
mfap4	R: GTTCTCTAGTCCCAGCCA

The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 54

Related Articles 0

Recommended Articles

Metrics

Comments