一例X染色体结构重排导致DMD疾病

doi:10.16288/j.yczz.22-179

[an error occurred while processing this directive]

Hereditas(Beijing) ›› 2023, Vol. 45 ›› Issue (1): 88-95.doi: 10.16288/j.yczz.22-179

• Genetic Resource • Previous Articles Next Articles

A DMD case caused by X chromosome rearrangement

Hao Hu^3,⁴(), Xiaowen Yang^3,⁴, Dehua Cheng^3,⁴, Xiurong Li^3,⁴, Wenbin He^3,⁴, Xiao Hu^3,⁴, Bodi Gao^3,⁴, Xiaomeng Zhao^3,⁴, Qianjun Zhang^1,^2,^3,⁴, Juan Du^1,^3,⁴, Jiyang Liu⁵, Guangxiu Lu^1,^2,^3,⁴, Lin Ge^1,^2,^3,⁴, Wen Li^1,^3,⁴()

1. Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Sciences, Central South University, Changsha 410078, China
2. National Engineering Research Center of Human Stem Cells, Changsha 410078, China
3. CITIC Xiangya Reproductive and Genetic Hospital, Changsha 410078, China
4. Hunan Provincial Clinical Research Center of Reproduction and Genetics, Changsha 410078, China
5. Municipal Health Commission of Changsha, Changsha 410023, China

Received:2022-09-26 Revised:2022-11-16 Online:2023-01-20 Published:2022-12-12
Contact: Li Wen E-mail:leonhu97@126.com;liwen1968@csu.edu.cn
Supported by:
Hunan Innovative Province Construction Special Fund(2019SK4012);the Health and Livelihood Project of Changsha(Comprehensive Prevention);the Health and Livelihood Project of Changsha(Control of Inherited Rare Disorders)

Abstract

Abstract:

Duchenne/Becker muscular dystrophy (DMD/BMD) is one of the most common progressive muscular dystrophy diseases with X-linked recessive inheritance. It is mainly caused by the deletion, duplication and point mutation of DMD gene. In rare cases, it is also caused by the destruction of DMD gene by chromosomal structural rearrangement. Here, we report a case of Duchenne/Becker Muscular dystrophy (DMD/BMD) with typical symptoms but unknown genetic defects after MLPA and next generation sequencing tests in other hospitals. Interestingly, we find a pericentric inversion of X chromosome (Chr.X: g. [31939463-31939465del; 31939466-131765063 inv; 131765064-131765067del]) in this patient. We then use the karyotyping, FISH, long-read sequencing and Sanger sequencing technologies to characterize the chromosome rearrangement. We find that this chromosomal aberration disrupt both the DMD gene and the HS6ST2 gene. The patient present with typical DMD symptoms such as muscle weakness, but no obvious symptoms of Paganini-Miozzo syndrome. Our results suggest that the destruction of DMD gene by structural rearrangement is also one of the important causes of DMD. Therefore, we suggest to provide further genetic testing for those DMD patients with unknown genetic defects through routine genetic testing. Cost-effective karyotyping and FISH should be considered firstly to identify chromosome rearrangements. Long-read sequencing followed by Sanger sequencing could be useful to locate the precise breakpoints. The genetic diagnosis of this case made it possible for reproductive intervention in the patient’s family.

Key words: DMD, structural rearrangement, karyotype, FISH, breakpoint analysis

Hao Hu, Xiaowen Yang, Dehua Cheng, Xiurong Li, Wenbin He, Xiao Hu, Bodi Gao, Xiaomeng Zhao, Qianjun Zhang, Juan Du, Jiyang Liu, Guangxiu Lu, Lin Ge, Wen Li. A DMD case caused by X chromosome rearrangement[J]. Hereditas(Beijing), 2023, 45(1): 88-95.

Figures/Tables 5

Fig. 1

Table 1

Fig. 2

Fig. 3

Fig. 4

References 12

[1]	Bladen CL, Salgado D, Monges S, Foncuberta ME, Kekou K, Kosma K, Dawkins H, Lamont L, Roy AJ, Chamova T, Guergueltcheva V, Chan S, Korngut L, Campbell C, Dai Y, Wang J, Barišić N, Brabec P, Lahdetie J, Walter MC, Schreiber-Katz O, Karcagi V, Garami M, Viswanathan V, Bayat F, Buccella F, Kimura E, Koeks Z, van den Bergen JC, Rodrigues M, Roxburgh R, Lusakowska A, Kostera- Pruszczyk A, Zimowski J, Santos R, Neagu E, Artemieva S, Rasic VM, Vojinovic D, Posada M, Bloetzer C, Jeannet PY, Joncourt F, Díaz-Manera J, Gallardo E, Karaduman AA, Topaloğlu H, Sherif RE, Stringer A, Shatillo AV, Martin AS, Peay HL, Bellgard MI, Kirschner J, Flanigan KM, Straub V, Bushby K, Verschuuren J, Aartsma-Rus A, Béroud C, Lochmüller H. The TREAT-NMD DMD Global Database: analysis of more than 7,000 Duchenne muscular dystrophy mutations. Hum Mutat, 2015, 36(4): 395-402.
[2]	Kong XD, Zhong XJ, Liu LN, Cui SY, Yang YX, Kong LR. Genetic analysis of 1051 Chinese families with Duchenne/ Becker Muscular Dystrophy. BMC Med Genet, 2019, 20(1): 139.
[3]	Crisafulli S, Sultana J, Fontana A, Salvo F, Messina S, Trifirò G. Global epidemiology of Duchenne muscular dystrophy: an updated systematic review and meta- analysis. Orphanet J Rare Dis, 2020, 15(1): 141.
[4]	Human Genome Mutation DatabaseHGMD[2022-08-01].https://my.qiagendigitalinsights.com/bbp/view/hgmd/pro/start.php.
[5]	Shashi V, Golden WL, Allinson PS, Blanton SH, von Kap- Herr C, Kelly TE. Molecular analysis of recombination in a family with Duchenne muscular dystrophy and a large pericentric X chromosome inversion. Am J Hum Genet, 1996, 58(6): 1231-1238.
[6]	Saito-Ohara F, Fukuda Y, Ito M, Agarwala KL, Hayashi M, Matsuo M, Imoto I, Yamakawa K, Nakamura Y, Inazawa J. The Xq 22 inversion breakpoint interrupted a novel Ras-like GTPase gene in a patient with Duchenne muscular dystrophy and profound mental retardation. Am J Hum Genet, 2002, 71(3): 637-645.
[7]	Bhat SS, Schmidt KR, Ladd S, Kim KC, Schwartz CE, Simensen RJ, DuPont BR, Stevenson RE, Srivastava AK. Disruption of DMD and deletion of ACSL4 causing developmental delay, hypotonia, and multiple congenital anomalies. Cytogenet Genome Res, 2006, 112(1-2): 170-175.
[8]	Kawashima H, Watanabe K, Morishima Y, Ioi H, Kashiwagi Y, Miyajima T, Takekuma K, Nishino I, Numabe H. High concentration of middle chain fatty acid in a case of Duchenne muscular dystrophy with severe mental retardation. Pediatr Int, 2012, 54(1): 137-140.
[9]	Tran THT, Zhang ZJ, Yagi M, Lee T, Awano H, Nishida A, Okinaga T, Takeshima Y, Matsuo M.Molecular characterization of an X(p21.2;q28) chromosomal inversion in a Duchenne muscular dystrophy patient with mental retardation reveals a novel long non-coding gene on Xq28. J Hum Genet, 2013, 58(1): 33-39.
[10]	Habuchi H, Miyake G, Nogami K, Kuroiwa A, Matsuda Y, Kusche-Gullberg M, Habuchi O, Tanaka M, Kimata K. Biosynthesis of heparan sulphate with diverse structures and functions: two alternatively spliced forms of human heparan sulphate 6-O-sulphotransferase-2 having different expression patterns and properties. Biochem J, 2003, 371(Pt 1): 131-142.
[11]	Habuchi H, Tanaka M, Habuchi O, Yoshida K, Suzuki H, Ban K, Kimata K. The occurrence of three isoforms of heparan sulfate 6-O-sulfotransferase having different specificities for hexuronic acid adjacent to the targeted N-sulfoglucosamine. J Biol Chem, 2000, 275(4): 2859- 2868.
[12]	Paganini L, Hadi LA, Chetta M, Rovina D, Fontana L, Colapietro P, Bonaparte E, Pezzani L, Marchisio P, Tabano SM, Costanza J, Sirchia SM, Riboni L, Milani D, Miozzo M. A HS6ST2 gene variant associated with X-linked intellectual disability and severe myopia in two male twins. Clin Genet, 2019, 95(3): 368-374.

Metrics

Comments

www.chinagene.cn
备案号：京ICP备09063187号

扩增片段	引物名称	引物序列(5'→3')	片段大小(bp)
1	DMD-F1	GTTTACTTGCTTTCTGCTTGGAT	520
1	HS6ST2-R1	GGGTTGCTTGAGGTAAGGAGT	520
2	DMD-F2	CAATGAGGTAGTAAATGGGAAAT	632
2	HS6ST2-R2	TGTGCCCAATGCTTGTTTC	632
3	DMD-F1	GTTTACTTGCTTTCTGCTTGGAT	570
3	DMD-F2	CAATGAGGTAGTAAATGGGAAAT	570
4	HS6ST2-R1	GGGTTGCTTGAGGTAAGGAGT	587
4	HS6ST2-R1	GGGTTGCTTGAGGTAAGGAGT	587

[1]	Kailun Li, Jingao Lu, Xiaohui Chen, Wenqing Zhang, Wei Liu. The role of the allantoin in promoting fracture healing in osteoclast-deficient zebrafish [J]. Hereditas(Beijing), 2023, 45(4): 341-353.
[2]	Jing’ao Lu, Chunyan Huang, Zhiyin Lin, Zheng Tang, Ning Ma, Zhibin Huang. The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish [J]. Hereditas(Beijing), 2022, 44(9): 798-809.
[3]	Pengfei Zheng, Haibo Xie, Panpan Zhu, Chengtian Zhao. Distribution pattern of floor plate neurons in zebrafish [J]. Hereditas(Beijing), 2022, 44(6): 510-520.
[4]	Tingting Zhang, Feng Liu. Study on a detection method of protein tyrosine sulfation modification in zebrafish [J]. Hereditas(Beijing), 2022, 44(2): 178-186.
[5]	Tingting Jia, Lei Lei, Xinyuan Wu, Shunyou Cai, Yixuan Chen, Yu Xue. Study on the mechanism of metformin on zebrafish skeletal development and damage repair [J]. Hereditas(Beijing), 2022, 44(1): 68-79.
[6]	Jiani Guo, Fan Liu, Lu Wang. Zebrafish blood disease models and applications [J]. Hereditas(Beijing), 2020, 42(8): 725-738.
[7]	Feng Xiong,Xunwei Xie,Luyuan Pan,Kuoyu Li,Liyue Liu,Yun Zhang,Linglu Li,Yonghua Sun. Development of resources, technologies and services at the China Zebrafish Resource Center [J]. Hereditas(Beijing), 2018, 40(8): 683-692.
[8]	Minglei Shi,Weili lai,Tianhong Yi,Xiao Ke,Zhihu Zhao. Characterization of the conbercept gene localization in DHFR- amplified CHO cells using fluorescence in situ hybridization [J]. Hereditas(Beijing), 2017, 39(4): 326-332.
[9]	Jingjin Xu, Wenjuan Zhang, Jingyi Wang, Liyun Yao, Yutian Pan, Yixin Ou, Yu Xue. The active component screening of Anoectochilus roxburghii and the functional study on inhibition of melanogenesis in zebrafish [J]. Hereditas(Beijing), 2017, 39(12): 1178-1187.
[10]	Shanshan Liu, Cuizhen Zhang, Gang Peng. Effects of starvation on the expression of feeding related neuropeptides in the larval zebrafish hypothalamus [J]. Hereditas(Beijing), 2016, 38(9): 821-830.
[11]	Fenghua Zhang, Houpeng Wang, Siyu Huang, Feng Xiong, Zuoyan Zhu, Yonghua Sun. A comparison of the knockout efficiencies of two codon-optimized Cas9 coding sequences in zebrafish embryos [J]. HEREDITAS(Beijing), 2016, 38(2): 144-154.
[12]	YAN Li-Feng GU Ai-Hua. Progress and application of zebrafish in regenerative medicine [J]. HEREDITAS, 2013, 35(7): 856-866.
[13]	OU Shan, DU Juan, CHEN Shao-Ke, ZHENG Chen-Guang, MENG Da-Hua, ZHANG Hai-Yan, QIU Qing-Ming, LIU Tian-Sheng, TANG Bin. Cytogenetic analysis of 105 new human abnormal karyotypes [J]. HEREDITAS, 2013, 35(7): 885-889.
[14]	LI Li, LUO Ling-Fei. Zebrafish as the model system to study organogenesis and regeneration [J]. HEREDITAS, 2013, 35(4): 421-432.
[15]	XU Ran-Ran ZHANG Cong-Wei CAO Yu WANG Qiang. mir122 deficiency inhibits differentiation of zebrafish hepa-toblast into hepatocyte [J]. HEREDITAS, 2013, 35(4): 488-494.

A DMD case caused by X chromosome rearrangement

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 12

Related Articles 15

Recommended Articles

Metrics

Comments