Hereditas(Beijing) ›› 2023, Vol. 45 ›› Issue (4): 341-353.doi: 10.16288/j.yczz.23-015
• Research Article • Previous Articles Next Articles
The role of the allantoin in promoting fracture healing in osteoclast-deficient zebrafish
Kailun Li(
), Jingao Lu, Xiaohui Chen, Wenqing Zhang(), Wei Liu()
- Division of Development Biology & Regenerative Medicine, South China University of Technology, Guangzhou 510006, China
-
Received:2023-01-18Revised:2023-02-27Online:2023-04-20Published:2023-03-22 -
Contact:Zhang Wenqing,Liu Wei E-mail:mckailun123@mail.scut.edu.cn;liuwei7@scut.edu.cn;mczhangwq@scut.edu.cn -
Supported by:National Key Research and Development Program of China(2018YFA0801000);National Natural Science Foundation of China(81770167)
Cite this article
Kailun Li, Jingao Lu, Xiaohui Chen, Wenqing Zhang, Wei Liu. The role of the allantoin in promoting fracture healing in osteoclast-deficient zebrafish[J]. Hereditas(Beijing), 2023, 45(4): 341-353.
share this article
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
The primer sequences used in this study"
| 基因名称 | 引物序列(5′→3′) |
|---|---|
| col1a | F：CTGGAAACCGTGGTGAATCT |
| R：GACCAGGATGTCCACGAAGT | |
| rankl | F：TAGTGTGGCGATTCTGTTGC |
| R：ATTGGAAGGTGAGCTGATGG | |
| opg | F：GGCGTCTGAAGAAACCTCTG |
| R：GCAGGATTGGGATGCAGTAT | |
| acp5b(trap) | F：TGTCATCGTGGTTGGTCACT |
| R：CTCAACACCAGCTCCACTGA | |
| ef-1α | F：TACTTCTCAGGCTGACTGTG |
| R：ATCTTCTTGATGTATGCGCT |
Table 1
Fig. 1
Establishing an osteoclast-deficient fracture model on fmsj4e1"
Fig. 1
Fig. 2
ALL could increase TRAP activity of osteoclasts on ex-vivo culturing scales"
Fig. 2
Fig. 3
The effect of allantoin on osteoclast activity and fracture healing in fmsj4e1 mutants"
Fig. 3
Fig. 4
ALL does not affect the production of osteoclast in fmsj4e1 mutants"
Fig. 4
Fig. 5
ALL promotes the maturation of osteoclast in fmsj4e1 mutants"
Fig. 5
| [1] |
Kanis JA, Odén A, Mccloskey EV, Johansson H, Wahl DA, Cooper C, IOF Working Group on Epidemiology and Quality of Life. A systematic review of hip fracture incidence and probability of fracture worldwide. Osteoporos Int, 2012, 23(9): 2239-2256.
pmid: 22419370 |
| [2] | Tzioupis C, Giannoudis PV. Prevalence of long-bone non-unions. Injury, 2007, 38: S3-S9. |
| [3] | Hak DJ, Fitzpatrick D, Bishop JA, Marsh JL, Tilp S, Schnettler R, Simpson H, Alt V. Delayed union and nonunions: epidemiology, clinical issues, and financial aspects. Injury, 2014, 45: S3-S7. |
| [4] |
Bahney CS, Zondervan RL, Allison P, Theologis A, Ashley JW, Ahn J, Miclau T, Marcucio RS, Hankenson KD. Cellular biology of fracture healing. J Orthop Res, 2019, 37(1): 35-50.
doi: 10.1002/jor.24170 pmid: 30370699 |
| [5] |
Schindeler A, Mcdonald MM, Bokko P, Little DG. Bone remodeling during fracture repair: the cellular picture. Semin Cell Dev Biol, 2008, 19(5): 459-466.
doi: 10.1016/j.semcdb.2008.07.004 pmid: 18692584 |
| [6] |
Takeyama K, Chatani M, Takano Y, Kudo A. In-vivo imaging of the fracture healing in medaka revealed two types of osteoclasts before and after the callus formation by osteoblasts. Dev Biol, 2014, 394(2): 292-304.
doi: 10.1016/j.ydbio.2014.08.007 |
| [7] |
Bhargava A, Vagela M, Lennox CME. "Challenges in the management of fractures in osteopetrosis"! Review of literature and technical tips learned from long-term management of seven patients. Injury, 2009, 40(11): 1167-1171.
doi: 10.1016/j.injury.2009.02.009 pmid: 19576583 |
| [8] | Strickland JP, Berry DJ. Total joint arthroplasty in patients with osteopetrosis:a report of 5 cases and review of the literature. J Arthroplasty, 2005, 20(6): 815-820. |
| [9] |
Xiao YL, Palomero J, Grabowska J, Wang LQ, De Rink I, Van Helvert L, Borst J. Macrophages and osteoclasts stem from a bipotent progenitor downstream of a macrophage/ osteoclast/dendritic cell progenitor. Blood Adv, 2017, 1(23): 1993-2006.
doi: 10.1182/bloodadvances.2017008540 |
| [10] |
Halasy-Nagy J, Hofstetter W. Expression of colony- stimulating factor-1 in vivo during the formation of osteoclasts. J Bone Miner Res, 1998, 13(8): 1267-1274.
pmid: 9718195 |
| [11] |
Kim JH, Kim N. Signaling pathways in osteoclast differentiation. Chonnam Med J, 2016, 52(1): 12-17.
doi: 10.4068/cmj.2016.52.1.12 pmid: 26865996 |
| [12] |
Mun SH, Park PSU, Park-Min KH. The M-CSF receptor in osteoclasts and beyond. Exp Mol Med, 2020, 52(8): 1239-1254.
doi: 10.1038/s12276-020-0484-z pmid: 32801364 |
| [13] |
Kim HH, Lee DE, Shin JN, Lee YS, Jeon YM, Chung CH, Ni J, Kwon BS, Lee ZH. Receptor activator of NF-kappaB recruits multiple TRAF family adaptors and activates c-Jun N-terminal kinase. FEBS Lett, 1999, 443(3): 297-302.
pmid: 10025951 |
| [14] |
Seita J, Weissman IL. Hematopoietic stem cell: self- renewal versus differentiation. Wiley Interdiscip Rev Syst Biol Med, 2010, 2(6): 640-653.
doi: 10.1002/wsbm.v2:6 |
| [15] |
Dai XM, Ryan GR, Hapel AJ, Dominguez MG, Russell RG, Kapp S, Sylvestre V, Stanley ER. Targeted disruption of the mouse colony-stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. Blood, 2002, 99(1): 111-120.
doi: 10.1182/blood.V99.1.111 |
| [16] |
Li J, Chen K, Zhu LY, Pollard JW. Conditional deletion of the colony stimulating factor-1 receptor (c-fms proto- oncogene) in mice. Genesis, 2006, 44(7): 328-335.
doi: 10.1002/(ISSN)1526-968X |
| [17] |
Liu W, Di QQ, Li KL, Li J, Ma N, Huang ZB, Chen JH, Zhang S, Zhang WQ, Zhang YY. The synergistic role of Pu.1 and Fms in zebrafish osteoclast-reducing osteopetrosis and possible therapeutic strategies. J Genet Genomics, 2020, 47(9): 535-546.
doi: 10.1016/j.jgg.2020.09.002 pmid: 33184003 |
| [18] |
Guo L, Bertola DR, Takanohashi A, Saito A, Segawa Y, Yokota T, Ishibashi S, Nishida Y, Yamamoto GL, Da Silva Franco JF, Honjo RS, Kim CA, Musso CM, Timmons M, Pizzino A, Taft RJ, Lajoie B, Knight MA, Fischbeck KH, Singleton AB, Ferreira CR, Wang Z, Yan L, Garbern JY, Simsek-Kiper PO, Ohashi H, Robey PG, Boyde A, Matsumoto N, Miyake N, Spranger J, Schiffmann R, Vanderver A, Nishimura G, Dos Santos Passos-Bueno MR, Simons C, Ishikawa K, Ikegawa S. Bi-allelic CSF1R mutations cause skeletal dysplasia of dysosteosclerosis- pyle disease spectrum and degenerative encephalopathy with brain malformation. Am J Hum Genet, 2019, 104(5): 925-935.
doi: 10.1016/j.ajhg.2019.03.004 |
| [19] | Witten PE, Harris MP, Huysseune A, Winkler C. Small teleost fish provide new insights into human skeletal diseases. Methods Cell Biol, 2017, 138: 321-346. |
| [20] |
Bergen DJM, Kague E, Hammond CL. Zebrafish as an emerging model for osteoporosis: a primary testing platform for screening new osteo-active compounds. Front Endocrinol (Lausanne), 2019, 10: 6.
doi: 10.3389/fendo.2019.00006 |
| [21] |
Sousa S, Valerio F, Jacinto A. A new zebrafish bone crush injury model. Biol Open, 2012, 1(9): 915-921.
doi: 10.1242/bio.2012877 pmid: 23213486 |
| [22] | Tomecka MJ, Ethiraj LP, Sánchez LM, Roehl HH, Carney TJ. Clinical pathologies of bone fracture modelled in zebrafish. Dis Model Mech, 2019, 12(9): dmm037630. |
| [23] |
Werner AK, Witte CP. The biochemistry of nitrogen mobilization: purine ring catabolism. Trends Plant Sci, 2011, 16(7): 381-387.
doi: 10.1016/j.tplants.2011.03.012 pmid: 21482173 |
| [24] |
Araújo LU, Grabe-Guimarães A, Mosqueira VCF, Carneiro CM, Silva-Barcellos NM. Profile of wound healing process induced by allantoin. Acta Cir Bras, 2010, 25(5): 460-466.
doi: S0102-86502010000500014 pmid: 20877959 |
| [25] |
Parichy DM, Ransom DG, Paw B, Zon LI, Johnson SL. An orthologue of the kit-related gene fms is required for development of neural crest-derived xanthophores and a subpopulation of adult melanocytes in the zebrafish, Danio rerio. Development, 2000, 127(14): 3031-3044.
doi: 10.1242/dev.127.14.3031 pmid: 10862741 |
| [26] | Westerfield M. The zebrafish book : a guide for the laboratory use of zebrafish (Danio rerio). Eugene: University of Oregon press, 1995. |
| [27] |
Shimizu T, Fujita N, Tsuji-Tamura K, Kitagawa Y, Fujisawa T, Tamura M, Sato M. Osteocytes as main responders to low-intensity pulsed ultrasound treatment during fracture healing. Sci Rep, 2021, 11(1): 10298.
doi: 10.1038/s41598-021-89672-9 pmid: 33986415 |
| [28] |
Pang P, Shimo T, Takada H, Matsumoto K, Yoshioka N, Ibaragi S, Sasaki A. Expression pattern of sonic hedgehog signaling and calcitonin gene-related peptide in the socket healing process after tooth extraction. Biochem Biophys Res Commun, 2015, 467(1): 21-26.
doi: 10.1016/j.bbrc.2015.09.139 |
| [29] | Moens C. Whole mount RNA in situ hybridization on zebrafish embryos: probe synthesis. CSH Protoc, 2008, 2008:pdb.prot5036. |
| [30] |
Jin H, Sood R, Xu J, Zhen FH, English MA, Liu PP, Wen ZL. Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI. Development, 2009, 136(4): 647-654.
doi: 10.1242/dev.029637 pmid: 19168679 |
| [31] |
Pasqualetti S, Banfi G, Mariotti M. Osteoblast and osteoclast behavior in zebrafish cultured scales. Cell Tissue Res, 2012, 350(1): 69-75.
doi: 10.1007/s00441-012-1436-2 pmid: 22669163 |
| [32] |
Babb SG, Matsudaira P, Sato M, Correia I, Lim SS. Fimbrin in podosomes of monocyte-derived osteoclasts. Cell Motil Cytoskeleton, 1997, 37(4): 308-325.
doi: 10.1002/(ISSN)1097-0169 |
| [33] | Morley SC. The actin-bundling protein L-plastin: a critical regulator of immune cell function. Int J Cell Biol, 2012, 2012: 935173. |
| [34] |
Zakrzewska A, Cui C, Stockhammer OW, Benard EL, Spaink HP, Meijer AH. Macrophage-specific gene functions in Spi1-directed innate immunity. Blood, 2010, 116(3): e1-e11.
doi: 10.1182/blood-2010-01-262873 |
| [35] |
Li N, Felber K, Elks P, Croucher P, Roehl HH. Tracking gene expression during zebrafish osteoblast differentiation. Dev Dyn, 2009, 238(2): 459-466.
doi: 10.1002/dvdy.21838 |
| [36] |
Silva I, Branco JC. Rank/Rankl/opg: literature review. Acta Reumatol Port, 2011, 36(3): 209-218
pmid: 22113597 |
| [37] |
Dahl N, Holmgren G, Holmberg S, Ersmark H. Fracture patterns in malignant osteopetrosis(Albers-Schönberg disease). Arch Orthop Trauma Surg, 1992, 111(2): 121-123.
doi: 10.1007/BF00443478 |
| [38] | De Palma L, Tulli A, Maccauro G, Sabetta SP, Del Torto M.Fracture callus in osteopetrosis. Clin Orthop Relat Res, 1994, (308): 85-89 |
| [39] |
Sobacchi C, Schulz A, Coxon FP, Villa A, Helfrich MH. Osteopetrosis: genetics, treatment and new insights into osteoclast function. Nat Rev Endocrinol, 2013, 9(9): 522-536.
doi: 10.1038/nrendo.2013.137 pmid: 23877423 |
| [40] |
Szabo M, Akusjärvi SS, Saxena A, Liu JP, Chandrasekar G, Kitambi SS. Cell and small animal models for phenotypic drug discovery. Drug Des Devel Ther, 2017, 11: 1957-1967.
doi: 10.2147/DDDT |
| [41] |
Zhang T, Han WQ, Zhao KX, Yang WL, Lu XY, Jia YW, Qin A, Qian Y. Psoralen accelerates bone fracture healing by activating both osteoclasts and osteoblasts. FASEB J, 2019, 33(4): 5399-5410.
doi: 10.1096/fj.201801797R pmid: 30702934 |
| [42] |
Gruber J, Tang SY, Jenner AM, Mudway I, Blomberg A, Behndig A, Kasiman K, Lee CYJ, Seet RCS, Zhang WX, Chen C, Kelly FJ, Halliwell B. Allantoin in human plasma, serum, and nasal-lining fluids as a biomarker of oxidative stress: avoiding artifacts and establishing real in vivo concentrations. Antioxid Redox Signal, 2009, 11(8): 1767-1776.
doi: 10.1089/ars.2008.2364 |
| [43] |
Araújo LU, Reis PG, Barbosa LCO, Saúde-Guimarães DA, Grabe-Guimarães A, Mosqueira VCF, Carneiro CM, Silva-Barcellos NM. In vivo wound healing effects of Symphytum officinale L. leaves extract in different topical formulations. Pharmazie, 2012, 67(4): 355-360
pmid: 22570943 |
| [44] |
Florentino IF, Silva DPB, Galdino PM, Lino RC, Martins JLR, Silva DM, De Paula JR, Tresvenzol LMF, Costa EA. Antinociceptive and anti-inflammatory effects of Memora nodosa and allantoin in mice. J Ethnopharmacol, 2016, 186: 298-304.
doi: S0378-8741(16)30201-X pmid: 27079223 |
| [1] | XIN Sheng-Chang, ZHAO Yan-Qiu, LI Song, LIN Shuo, ZHONG Han-Bing. Application of zebrafish models in drug screening [J]. HEREDITAS, 2012, 34(9): 1144-1152. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
