Hereditas(Beijing) ›› 2021, Vol. 43 ›› Issue (7): 680-693.doi: 10.16288/j.yczz.21-154
• Research Article • Previous Articles Next Articles
Xiangwei Tang(
), Dan Chu, Saina Yan, Yanfei Yin, Qiao Bian, Bo Weng, Bin Chen, Maoliang Ran
Received:2021-04-25
Revised:2021-06-02
Online:2021-07-20
Published:2021-06-11
Supported by:Xiangwei Tang, Dan Chu, Saina Yan, Yanfei Yin, Qiao Bian, Bo Weng, Bin Chen, Maoliang Ran. MiR-191 promotes the porcine immature Sertoli cell proliferation by targeting the BDNF gene through activating the PI3K/AKT signaling pathway[J]. Hereditas(Beijing), 2021, 43(7): 680-693.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
Primer sequences used in this study"
| 基因 | 引物序列(5′→ 3′) |
|---|---|
| CCND1 | F: TACACCGACAACTCCATCCG |
| R: GCCGCCAGGTTCCACTT | |
| CCNE1 | F: CCTGCTGAAGATGCCCATAAC |
| R: TGCTCTGCTTCTTACTGCTCG | |
| CDK-4 | F: GTGGCCCTCAAGAGCGTAAG |
| R: CAGACATCCATCAGCCGGAC | |
| c-MYC | F: AACCCTTGGCTCTCCACGAG |
| R: ATTCCGACCTTTTGGCAGGG | |
| FGF2 | F: ACCAGGTCACTGAGATCCATCCAC |
| R: TTCGGCAACAGCACACCAATCC | |
| BMP4 | F: ACCAATCATGCCATCGTTCAGACC |
| R: TGATTCAGCGGCAACCACATCC | |
| GDNF | F: GAGACCGCTGTGTATCGCATTCC |
| R: GCCTTCTTCCTCTTCCTCCTCCTC | |
| PCNA | F: ATTTGGCCATGGGCGTGAAC |
| R: CTAGTGCCAAGGTGTCTGCAT | |
| EGF | F: GCGAGCGATGTCAGCACAGAG |
| R: AGGAGCAGCAGCAGGACCAG | |
| TBP | F: GCGATTTGCTGCTGTAATCA |
| R: CCCCACCATGTTCTGAATCT |
| [1] |
Franca LR, Hess RA, Dufour JM, Hofmann MC, Griswold MD. The Sertoli cell: one hundred fifty years of beauty and plasticity. Andrology, 2016, 4(2):189-212.
doi: 10.1111/andr.12165 |
| [2] |
Rebourcet D, Darbey A, Monteiro A, Soffientini U, Tsai YT, Handel I, Pitetti JL, Nef S, Smith LB, O'Shaughnessy PJ. Sertoli cell number defines and predicts germ and leydig cell population sizes in the adult mouse testis. Endocrinology, 2017, 158(9):2955-2969.
doi: 10.1210/en.2017-00196 pmid: 28911170 |
| [3] |
Bertoldo MJ, Guibert E, Faure M, Guillou F, RaméC, Nadal-Desbarats L, Foretz M, Viollet B, Dupont J, Froment P. Specific deletion of AMP-activated protein kinase (α1AMPK) in mouse Sertoli cells modifies germ cell quality. Mol Cell Endocrinol, 2016, 423:96-112.
doi: 10.1016/j.mce.2016.01.001 pmid: 26772142 |
| [4] |
Ran ML, Chen B, Wu MS, Liu XC, He CQ, Yang AQ, Li Z, Xiang YJ, Li ZH, Zhang SW. Integrated analysis of miRNA and mRNA expression profiles in development of porcine testes. Rsc Adv, 2015, 5(78):63439-63449.
doi: 10.1039/C5RA07488F |
| [5] |
Ding HS, Liu M, Zhou CF, You XB, Su T, Yang YB, Xu DQ. Integrated analysis of miRNA and mRNA expression profiles in testes of Duroc and Meishan boars. BMC Genomics, 2020, 21(1):686.
doi: 10.1186/s12864-020-07096-7 |
| [6] |
Luo ZY, Dai XL, Ran XQ, Cen YX, Niu X, Li S, Huang SH, Wang JF. Identification and profile of microRNAs in Xiang pig testes in four different ages detected by Solexa sequencing. Theriogenology, 2018, 117:61-71.
doi: 10.1016/j.theriogenology.2017.06.023 |
| [7] |
Chen XX, Zheng Y, Li XL, Gao Q, Feng TY, Zhang PF, Liao MZ, Tian XE, Lu HZ, Zeng WX. Profiling of miRNAs in porcine Sertoli cells. J Anim Sci Biotechnol, 2020, 11:85.
doi: 10.1186/s40104-020-00487-6 |
| [8] |
Ma CP, Song HB, Yu L, Guan KF, Hu PD, Li Y, Xia XY, Li JL, Jiang SW, Li FG. miR-762 promotes porcine immature Sertoli cell growth via the ring finger protein 4 (RNF4) gene. Sci Rep, 2016, 6:32783.
doi: 10.1038/srep32783 |
| [9] |
Zhang SX, Guo J, Liang MD, Qi JJ, Wang ZB, Jian XR, Zhang ZB, Sun BX, Li ZH. miR-196a promotes proliferation and inhibits apoptosis of immature porcine Sertoli cells. DNA Cell Biol, 2019, 38(1):41-48.
doi: 10.1089/dna.2018.4387 |
| [10] | Gao H, Ran ML, Luo H, Weng B, Tang XW, Chen Y, Yang AQ, Chen B. miR-499 promotes immature porcine Sertoli cell growth by the PI3K/AKT pathway by targeting the PTEN gene. Reproduction, 2019, 152(2):145-157. |
| [11] |
Hu Y, Deng J, Tian K, Yang WR, Luo NJ, Lian Y, Gan L, Tang XY, Luo HY, Zhang JJ, Wang XZ. MiR-8-3p regulates hyperthermia-induced lactate secretion by targeting PPP2R5B in boar Sertoli cells. Mol Reprod Dev, 2019, 86(11):1720-1730.
doi: 10.1002/mrd.v86.11 |
| [12] |
Guo J, Yang C, Zhang SX, Liang MD, Qi JJ, Wang ZB, Peng YH, Sun BX. MiR-375 induces ROS and apoptosis in ST cells by targeting the HIGD1A gene. Gene, 2019, 685:136-142.
doi: 10.1016/j.gene.2018.10.086 |
| [13] |
Zhang JJ, Wang Y, Yang WR, Kee JD, Wang XZ. MicroRNA-1285 regulates 17β-estradiol-inhibited immature boar Sertoli cell proliferation via adenosine monophosphate-activated protein kinase activation. Endocrinology, 2015, 156(11):4059-4070.
doi: 10.1210/en.2014-1982 pmid: 26287402 |
| [14] |
Ran M, Li Z, Cao R, Weng B, Peng F, He C, Chen B. miR-26a suppresses autophagy in swine Sertoli cells by targeting ULK2. Reprod Domest Anim, 2018, 53(4):864-871.
doi: 10.1111/rda.2018.53.issue-4 |
| [15] |
Luo H, Chen B, Weng B, Tang XW, Chen Y, Yang AQ, Chu D, Zeng XY, Ran ML. miR-130a promotes immature porcine Sertoli cell growth by activating SMAD5 through the TGF-β-PI3K/AKT signaling pathway. FASEB J, 2020, 34(11):15164-15179.
doi: 10.1096/fsb2.v34.11 |
| [16] | Tian F, Yu CT, Wu M, Wu XY, Wan LF, Zhu XJ. MicroRNA-191 promotes hepatocellular carcinoma cell proliferation by has_circ_0000204/miR-191/KLF6 axis. Cell Prolif, 2019, 52(5):e12635. |
| [17] |
Gao XT, Xie ZQ, Wang ZG, Cheng KL, Liang K, Song ZQ. Overexpression of miR-191 predicts poor prognosis and promotes proliferation and invasion in esophageal squamous cell carcinoma. Yonsei Med J, 2017, 58(6):1101-1110.
doi: 10.3349/ymj.2017.58.6.1101 |
| [18] |
Polioudakis D, Abell NS, Iyer VR. MiR-191 regulates primary human fibroblast proliferation and directly targets multiple oncogenes. PLoS One, 2015, 10(5):e0126535.
doi: 10.1371/journal.pone.0126535 |
| [19] |
Ma CP, Song HB, Guan KF, Zhou JW, Xia XY, Li FG. Characterization of swine testicular cell line as immature porcine Sertoli cell line. In Vitro Cell Dev Biol Anim, 2016, 52(4):427-433.
doi: 10.1007/s11626-015-9994-8 |
| [20] |
Ni FD, Hao SL, Yang WX. Multiple signaling pathways in Sertoli cells: recent findings in spermatogenesis. Cell Death Dis, 2019, 10(8):541.
doi: 10.1038/s41419-019-1782-z |
| [21] |
Berger T, Nitta-Oda BJ. Sertoli cell proliferation in juvenile boars and microRNA. Livest Sci, 2020, 233:103954.
doi: 10.1016/j.livsci.2020.103954 |
| [22] |
Kang PC, Leng KM, Liu YP, Liu Y, Xu Y, Qin W, Gao JJ, Wang ZD, Tai S, Zhong XY, Cui YF. miR-191 inhibition induces apoptosis through reactivating secreted frizzled- related protein-1 in cholangiocarcinoma. Cell Physiol Biochem, 2018, 49(5):1933-1942.
doi: 10.1159/000493654 |
| [23] |
Sharma S, Nagpal N, Ghosh PC, Kulshreshtha R. P53-miR-191-SOX4 regulatory loop affects apoptosis in breast cancer. RNA, 2017, 23(8):1237-1246.
doi: 10.1261/rna.060657.117 |
| [24] | Tian XY, Xu LM, Wang P. MiR-191 inhibits TNF-α induced apoptosis of ovarian endometriosis and endometrioid carcinoma cells by targeting DAPK1. Int J Clin Exp Pathol, 2015, 8(5):4933-4942. |
| [25] |
Varendi K, Kumar A, Härma MA, Andressoo JO. miR-1, miR-10b, miR-155, and miR-191 are novel regulators of BDNF. Cell Mol Life Sci, 2014, 71(22):4443-4456.
doi: 10.1007/s00018-014-1628-x pmid: 24804980 |
| [26] |
Li HX, Du MQ, Xu WM, Wang ZF. MiR-191 downregulation protects against isoflurane-induced neurotoxicity through targeting BDNF. Toxicol Mech Methods, 2021, 31(5):367-373.
doi: 10.1080/15376516.2021.1886211 |
| [27] |
Mohammadipoor-Ghasemabad L, Sangtarash MH, Sheibani V, Sasan HA, Esmaeili-Mahani S. Hippocampal microRNA- 191a-5p regulates BDNF expression and shows correlation with cognitive impairment induced by paradoxical sleep deprivation. Neuroscience, 2019, 414:49-59.
doi: S0306-4522(19)30464-6 pmid: 31279826 |
| [28] |
Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Martin GR, Bishop JM. c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature, 2001, 414(6865):768-773.
doi: 10.1038/414768a |
| [29] |
Ramana KV, Tammali R, Srivastava SK. Inhibition of aldose reductase prevents growth factor-induced G1-S phase transition through the AKT/phosphoinositide 3-kinase/ E2F-1 pathway in human colon cancer cells. Mol Cancer Ther, 2010, 9(4):813-824.
doi: 10.1158/1535-7163.MCT-09-0795 pmid: 20354121 |
| [30] | Blum Y, Mikelson J, Dobrzynski M, Ryu H, Jacques MA, Jeon NL, Khammash M, Pertz O. Temporal perturbation of ERK dynamics reveals network architecture of FGF2/ MAPK signaling. Mol Syst Biol, 2019, 15(11):e8947. |
| [31] |
Strzalka W, Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation. Ann Bot, 2011, 107(7):1127-1140.
doi: 10.1093/aob/mcq243 |
| [32] | Duval N, Vaslin C, Barata TC, Frarma Y, Contremoulins V, Baudin X, Nedelec S, Ribes VC. BMP4 patterns Smad activity and generates stereotyped cell fate organization in spinal organoids. Development, 2019, 146(14):175430. |
| [33] |
Volkmann N, Marassi FM, Newmeyer DD, Hanein D. The rheostat in the membrane: Bcl-2 family proteins and apoptosis. Cell Death Differ, 2014, 21(2):206-215.
doi: 10.1038/cdd.2013.153 pmid: 24162659 |
| [34] | Correia C, Lee SH, Meng XW, Vincelette ND, Knorr KLB, Ding HS, Nowakowski GS, Dai HM, Kaufmann SH. Emerging understanding of Bcl-2 biology: implications for neoplastic progression and treatment. Biochim Biophys Acta, 2015, 1853(7):1658-1671. |
| [35] |
Savitskaya MA, Onishchenko GE. Mechanisms of apoptosis. Biochemistry (Mosc), 2015, 80(11):1393-1405.
doi: 10.1134/S0006297915110012 |
| [36] |
Riera MF, Regueira M, Galardo MN, Pellizzari EH, Meroni SB, Cigorraga SB. Signal transduction pathways in FSH regulation of rat Sertoli cell proliferation. Am J Physiol Endocrinol Metab, 2012, 302(8):E914-E923.
doi: 10.1152/ajpendo.00477.2011 |
| [37] |
Sun Y, Yang WR, Luo HL, Wang XZ, Chen ZQ, Zhang JJ, Wang Y, Li XM. Thyroid hormone inhibits the proliferation of piglet Sertoli cell via PI3K signaling pathway. Theriogenology, 2015, 83(1):86-94.
doi: 10.1016/j.theriogenology.2014.08.003 pmid: 25284282 |
| [38] |
Wang C, Zheng P, Adeniran SO, Ma MJ, Huang FS, Adegoke EO, Zhang GX. Thyroid hormone (T3) is involved in inhibiting the proliferation of newborn calf Sertoli cells via the PI3K/Akt signaling pathway in vitro. Theriogenology, 2019, 133:1-9.
doi: 10.1016/j.theriogenology.2019.04.025 |
| [39] |
Yang WR, Zhu FW, Zhang JJ, Wang Y, Zhang JH, Lu C, Wang XZ. PI3K/Akt activated by GPR30 and Src regulates 17β-estradiol-induced cultured immature boar Sertoli cells proliferation. Reprod Sci, 2017, 24(1):57-66.
doi: 10.1177/1933719116649696 |
| [40] |
Hu PD, Guan KF, Feng Y, Ma CP, Song HB, Li Y, Xia XY, Li JL, Li FG. miR-638 inhibits immature Sertoli cell growth by indirectly inactivating PI3K/AKT pathway via SPAG1 gene. Cell Cycle, 2017, 16(23):2290-2300.
doi: 10.1080/15384101.2017.1380130 |
| [41] |
Luo H, Peng FZ, Weng B, Tang XW, Chen Y, Yang AQ, Chen B, Ran ML. miR-222 suppresses immature porcine Sertoli cell growth by targeting the GRB10 gene through inactivating the PI3K/AKT signaling pathway. Front Genet, 2020, 11:581593.
doi: 10.3389/fgene.2020.581593 |
| No related articles found! |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
www.chinagene.cn
备案号:京ICP备09063187号