AtCPS V326M突变显著影响赤霉素合成

doi:10.16288/j.yczz.21-405

[an error occurred while processing this directive]

Hereditas(Beijing) ›› 2022, Vol. 44 ›› Issue (3): 245-252.doi: 10.16288/j.yczz.21-405

• Research Article • Previous Articles Next Articles

AtCPS V326M significantly affect the biosynthesis of gibberellins

Sanzeng Zhao¹(), Danyu Kong², Peiyong Xin³, Jinfang Chu^3,⁵, Yinglang Wan¹, Hong-Qing Ling^4,⁵(), Yi Liu^2,⁴()

1. College of Tropical Crops, Hainan University, Haikou 570228, China
2. Lushan Botanical Garden, Chinese Academy of Sciences, Lushan 332900, China
3. National Centre for Plant Gene Research (Beijing), Innovation Academy for Seed Design, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
4. State Key Laboratory of Plant Cell and Chromosome Engineering, Innovation Academy for Seed Design, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
5. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100039, China;

Received:2021-11-26 Revised:2022-01-19 Online:2022-03-20 Published:2022-02-22
Contact: Ling Hong-Qing,Liu Yi E-mail:834395875@qq.com;hqling@genetics.ac.cn;yiliu609@outlook.com
Supported by:
Supported by the National Natural Science Foundation of China(31900171)

Abstract

Abstract:

Gibberellins are a class of typical phytohormones, which regulate plant growth and development. The contents of gibberellins dramatically affect the morphology and biomass of plant. The encoding protein of copalyl diphosphate synthase gene (CPS) catalyzes the first-step in the biosynthetic pathway of gibberellins. The mutation in this gene may significantly affect the contents of gibberellins in plants. In this study, we found an EMS-triggered mutant, ga1-168, showing short roots, short hypocotyls, late flowering and dwarf. Map-based cloning revealed that the causal gene of ga1-168 was AtCPS-168, an allele of AtCPS gene. The encoding protein of AtCPS-168 was AtCPS V326M which was resulted from a single-point mutation (guanine to adenine at nucleotide 2768) of AtCPS gene. Protein domain analysis showed that V326 was located in the Terpene_synth domain. The allelism test demonstrated that AtCPS-168 was an allele of AtCPS gene. The transgenic complementation of ga1-168 indicated that AtCPS V326M led to the dwarf and bushy phenotype of ga1-168. The endogenous gibberellins contents analysis suggested that the gibberellins contents of ga1-168 were much lower than that of wild-type. The exogenous GA₃ application assay uncovered that application of GA₃ can complement the dwarf and bushy phenotype of ga1-168 caused by low endogenous gibberellins contents. Therefore, this study suggested that it is an elegant way to create the ideal plant architecture and height by site-directed mutating the gibberellin biosynthetic genes.

Key words: gibberellins, AtCPS gene, root length, plant architecture, plant height

Sanzeng Zhao, Danyu Kong, Peiyong Xin, Jinfang Chu, Yinglang Wan, Hong-Qing Ling, Yi Liu. AtCPS V326M significantly affect the biosynthesis of gibberellins[J]. Hereditas(Beijing), 2022, 44(3): 245-252.

Figures/Tables 6

Table 1

Fig. 1

Fig.2

Fig. 3

Fig. 4

Table 2

References 23

[1]	Hedden P, Sponsel V. A century of gibberellin research. J Plant Growth Regul, 2015,34(4):740-760.
[2]	Hernández-García J, Briones-Moreno A, Blázquez MA. Origin and evolution of gibberellin signaling and metabolism in plants. Semin Cell Dev Biol, 2021,109:46-54.
[3]	Davière JM, Achard P. Gibberellin signaling in plants. Development, 2013,140(6):1147-1151.
[4]	Claeys H, De Bodt S, Inzé D. Gibberellins and DELLAs: central nodes in growth regulatory networks. Trends Plant Sci, 2014,19(4):231-239.
[5]	Hedden P, Thomas SG. Gibberellin biosynthesis and its regulation. Biochem J, 2012,444(1):11-25.
[6]	Salazar-Cerezo S, Martínez-Montiel N, García-Sánchez J, Pérez-Y-Terrón R, Martínez-Contreras RD. Gibberellin biosynthesis and metabolism: a convergent route for plants, fungi and bacteria. Microbiol Res, 2018,208:85-98.
[7]	Sun TP, Kamiya Y. The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. italic>Plant Cell, 1994,6(10):1509-1518.
[8]	Hedden P. The current status of research on gibberellin biosynthesis. Plant Cell Physiol, 2020,61(11):1832-1849.
[9]	Fleet CM, Yamaguchi S, Hanada A, Kawaide H, David CJ, Kamiya Y, Sun TP. Overexpression of AtCPS and AtKS in Arabidopsis confers increased ent-kaurene production but no increase in bioactive gibberellins. Plant Physiol, 2003,132(2):830-839.
[10]	Hayashi K, Kawaide H, Notomi M, Sakigi Y, Matsuo A, Nozaki H. Identification and functional analysis of bifunctional ent-kaurene synthase from the moss Physcomitrella patens. FEBS Lett, 2006,580(26):6175-6181.
[11]	Otomo K, Kenmoku H, Oikawa H, König WA, Toshima H, Mitsuhashi W, Yamane H, Sassa T, Toyomasu T. Biological functions of ent- and syn-copalyl diphosphate synthases in rice: key enzymes for the branch point of gibberellin and phytoalexin biosynthesis. Plant J, 2004,39(6):886-893.
[12]	Prisic S, Xu MM, Wilderman PR, Peters RJ. Rice contains two disparate ent-copalyl diphosphate synthases with distinct metabolic functions. Plant Physiol, 2004,136(4):4228-4236.
[13]	Toyomasu T, Usui M, Sugawara C, Kanno Y, Sakai A, Takahashi H, Nakazono M, Kuroda M, Miyamoto K, Morimoto Y, Mitsuhashi W, Okada K, Yamaguchi S, Yamane H. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles. J Exp Bot, 2015,66(1):369-376.
[14]	Xu MM, Hillwig ML, Prisic S, Coates RM, Peters RJ. Functional identification of rice syn-copalyl diphosphate synthase and its role in initiating biosynthesis of diterpenoid phytoalexin/allelopathic natural products. Plant J, 2004,39(3):309-318.
[15]	Gao SP, Chu CC. Gibberellin metabolism and signaling: Targets for improving agronomic performance of crops. Plant Cell Physiol, 2020,61(11):1902-1911.
[16]	Hedden P. The genes of the Green Revolution. Trends Genet, 2003,19(1):5-9.
[17]	Ling HQ, Bauer P, Bereczky Z, Keller B, Ganal M. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc Natl Acad Sci USA, 2002,99(21):13938-13943.
[18]	He J, Chen QW, Xin PY, Yuan J, Ma YH, Wang XM, Xu MM, Chu JF, Peters RJ, Wang GD. CYP72A enzymes catalyse 13-hydrolyzation of gibberellins. Nat Plants, 2019,5(10):1057-1065.
[19]	Shimane M, Ueno Y, Morisaki K, Oogami S, Natsume M, Hayashi K, Nozaki H, Kawaide H. Molecular evolution of the substrate specificity of ent-kaurene synthases to adapt to gibberellin biosynthesis in land plants. Biochem J, 2014,462(3):539-546.
[20]	Köksal M, Hu HY, Coates RM, Peters RJ, Christianson DW. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase. Nat Chem Biol, 2011,7(7):431-433.
[21]	Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Žídek A, Potapenko A, Bridgland A, Meyer C, Kohl SAA, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D. Highly accurate protein structure prediction with AlphaFold. Nature, 2021,596(7873):583-589.
[22]	Hu XM, Cui YT, Dong GJ, Feng AH, Wang DY, Zhao CY, Zhang Y, Hu J, Zeng DL, Guo LB, Qian Q. Using CRISPR-Cas9 to generate semi-dwarf rice lines in elite landraces. Sci Rep, 2019,9(1):19096.
[23]	Köksal M, Potter K, Peters RJ, Christianson DW. 1.55Å-resolution structure of ent-copalyl diphosphate synthase and exploration of general acid function by site-directed mutagenesis. Biochim Biophys Acta, 2014,1840(1):184-190.

Metrics

Comments

www.chinagene.cn
备案号：京ICP备09063187号

用途	引物名称	序列(5′→3′)
SSLP 分子标记	CIW5 LP	GGTTAAAAATTAGGGTTACGA
	CIW5 RP	AGATTTACGTGGAAGCAAT
	F4C21 LP	GAGATTGCTCGGTTTGATTG
	F4C21 RP	ACAAGGATACGGTGTTAGAG
	T4I9 LP	ACAGAATCTGATGGAATATG
	T4I9 RP	AACTATTGTGCGTAAACATC
CAPS 分子标记	T5J8 Dde I LP	AGAGTGGTTTGAATCTGAAG
	T5J8 Dde I RP	CTGTCCTAGCTTATAACTTG
	T5J8 Hpy178 III LP	ATAGCTATGTGCAGAACAAG
	T5J8 Hpy178 III RP	TATCATACTGAGATACTCCG

	GA₁₂	GA₁₅	GA₃₄	GA₄	GA₉	GA₂₀	GA₂₄	GA₄₄	GA₅₁
Col-0	0.603±0.048	0.505±0.007	1.000±0.071	0.466±0.026	0.207±0.014	0.399±0.013	1.550± 0.081	0.220±0.026	0.732±0.059
ga1-168	0.019±0.004	0.246±0.015	0.149±0.018	ND	ND	ND	ND	ND	ND

AtCPS V326M significantly affect the biosynthesis of gibberellins

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 6

References 23

Related Articles 7

Recommended Articles

Metrics

Comments

[1]	Zhenwu Zheng, Hongyuan Zhao, Xiaoya Liang, Yijun Wang, Chihang Wang, Gaoyan Gong, Jinyan Huang, Guiquan Zhang, Shaokui Wang, Zupei Liu. qGL3.4 controls kernel size and plant architecture in rice [J]. Hereditas(Beijing), 2023, 45(9): 835-844.
[2]	GAO Li-Fang GUO Yong HAO Zai-Bin QIU Li-Juan. Integration and “Overview” analysis of QTLs related to plant height in soybean [J]. HEREDITAS, 2013, 35(2): 215-224.
[3]	Chengcai Chu. The Cover story description [J]. HEREDITAS, 2012, 34(11): 1389-1389.
[4]	OU Shu-Jun, WANG Hong-Ru, CHU Cheng-Cai. Major domestication traits in Asian rice [J]. HEREDITAS, 2012, 34(11): 1379-1389.
[5]	ZHANG Yu-Shan, WU Wei, XU Cai-Guo. Two pleiotropic intervals of rice were assessed using NILs constructed by two methods [J]. HEREDITAS, 2008, 30(6): 781-787.
[6]	YANG Xiao-Jun, LU Ming, ZHANG Shi-Huang, ZHOU Fang, QU Yan-Ying, XIE Chuan-Xiao. QTL mapping of plant height and ear position in maize (Zea mays L.) [J]. HEREDITAS, 2008, 30(11): 1477-1486.
[7]	WANG Rong, CUI Bai-Ming, PENG Ming, ZHANG Gen-Fa. Gibberellin signal transduction and cotton fiber molecular development [J]. HEREDITAS, 2007, 29(3): 276-276―282.