Hereditas(Beijing) ›› 2026, Vol. 48 ›› Issue (6): 601-613.doi: 10.16288/j.yczz.26-004
• Research Article • Previous Articles Next Articles
Changhao Ji(
), Nuan Wang, Xinyang Wang, Meizhu Zhang, Jin Sun(
)
Received:2026-01-14
Revised:2026-02-16
Online:2026-04-24
Published:2026-04-24
Contact:
Jin Sun
E-mail:1051482846@qq.com;sunjin@sdfmu.edu.cn
Supported by:Changhao Ji, Nuan Wang, Xinyang Wang, Meizhu Zhang, Jin Sun. Role of broad in intestinal stem cells of adult Drosophila[J]. Hereditas(Beijing), 2026, 48(6): 601-613.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
Primer sequences used in this study"
| 引物名称 | 序列(5′→3′) | 用途 |
|---|---|---|
| br-F | ATCCCATATTCAGCCGCTAGCATGGACGACACACAGCACTT | br-OE果蝇构建 |
| br-R1 | TAGATCTTCTCGAGTGGATCCGCCCTATGAAGAGGAGTGGT | |
| br-R2 | TAGATCTTCTCGAGTGGATCCTAGTTGCTCGTGGTGGCAA | |
| br-R3 | TAGATCTTCTCGAGTGGATCCTCCTATTGGATGCCCGGTGG | |
| br-R4 | TAGATCTTCTCGAGTGGATCCGCCTTGCTTATTGGTCTAGT | |
| nub-F1 | AAGATCTGGAATTCAGCTAGTTCGGTGAAATCGGCCACAG | nub-HA果蝇构建 |
| nub-R1 | GATCTCGGATCCTTAGCTAGCGTGCATCATATAGGAGGACTCG | |
| nub-F2 | ATGCACGCTAGCTAAGGATCCGAGATCAAGGATCGTCTATGGAC | |
| nub-R2 | CCAATTGGTCTAGACGGATCTTCCCTCGGTCGAATTCCGT | |
| HA-F | CTAGCTACCCATACGATGTTCCAGATTACGCTTAAG | |
| HA-R | GATCCTTAAGCGTAATCTGGAACATCGTATGGGTAG | |
| nub-sgRNA-F | TTCGAAGCGCATCAATCCCTCCC | |
| nub-sgRNA-R | AAACGGGAGGGATTGATGCGCTT | |
| dome-F | GGCGGCGACTTTAATCTGAG | 实时荧光定量PCR |
| dome-R | GGTGTTGTTCAGGATTCGGAT | |
| stat92E-F | CAACAATCCACCCACAGTCGAG | |
| stat92E-R | GTATTGCGCGTAACGAAC |
| [1] |
Sharpless NE, DePinho RA. How stem cells age and why this makes us grow old. Nat Rev Mol Cell Biol, 2007, 8(9): 703-713.
pmid: 17717515 |
| [2] |
Visvader JE, Lindeman GJ. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer, 2008, 8(10): 755-768.
pmid: 18784658 |
| [3] | Trivanović D. Adult stem cells in aging. J Pers Med, 2022, 12(5): 795. |
| [4] |
Hsu YC, Li LS, Fuchs E. Emerging interactions between skin stem cells and their niches. Nat Med, 2014, 20(8): 847-856.
pmid: 25100530 |
| [5] |
Gadhave DG, Sugandhi VV, Jha SK, Nangare SN, Gupta G, Singh SK, Dua K, Cho H, Hansbro PM, Paudel KR. Neurodegenerative disorders: mechanisms of degeneration and therapeutic approaches with their clinical relevance. Ageing Res Rev, 2024, 99: 102357.
pmid: 38830548 |
| [6] |
Shao B, Yang W, Cao Q. Landscape and predictions of inflammatory bowel disease in China: China will enter the Compounding Prevalence stage around 2030. Front Public Health, 2022, 10: 1032679.
pmid: 36388296 |
| [7] |
Zheng R, Zhang S, Zeng H, Wang S, Sun K, Chen R, Li L, Wei W, He J. Cancer incidence and mortality in China, 2016. J Natl Cancer Cent, 2022, 2(1): 1-9.
pmid: 39035212 |
| [8] |
Micchelli CA, Perrimon N. Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature, 2006, 439(7075): 475-479.
pmid: 16340959 |
| [9] |
Ohlstein B, Spradling A. The adult Drosophila posterior midgut is maintained by pluripotent stem cells. Nature, 2006, 439(7075): 470-474.
pmid: 16340960 |
| [10] |
Ohlstein B, Spradling A. Multipotent Drosophila intestinal stem cells specify daughter cell fates by differential notch signaling. Science, 2007, 315(5814): 988-992.
pmid: 17303754 |
| [11] |
Zeng X, Hou SX. Enteroendocrine cells are generated from stem cells through a distinct progenitor in the adult Drosophila posterior midgut. Development, 2015, 142(4): 644-653.
pmid: 25670791 |
| [12] |
Chen J, Xu N, Wang C, Huang P, Huang H, Jin Z, Yu Z, Cai T, Jiao R, Xi R. Transient scute activation via a self-stimulatory loop directs enteroendocrine cell pair specification from self-renewing intestinal stem cells. Nat Cell Biol, 2018, 20(2):152-161.
pmid: 29335529 |
| [13] |
Miguel-Aliaga I, Jasper H, Lemaitre B. Anatomy and physiology of the digestive tract of Drosophila melanogaster. Genetics, 2018, 210(2):357-396.
pmid: 30287514 |
| [14] |
Guo X, Lv J, Xi R. The specification and function of enteroendocrine cells in Drosophila and mammals: a comparative review. FEBS J, 2022, 289(16): 4773-4796.
pmid: 34115929 |
| [15] |
Tang R, Qin P, Liu X, Wu S, Yao R, Cai G, Gao J, Wu Y, Guo Z. Intravital imaging strategy FlyVAB reveals the dependence of Drosophila enteroblast differentiation on the local physiology. Commun Biol, 2021, 4(1): 1223.
pmid: 34697396 |
| [16] |
Amcheslavsky A, Jiang J, Ip YT. Tissue damage-induced intestinal stem cell division in Drosophila. Cell Stem Cell, 2009, 4(1): 49-61.
pmid: 19128792 |
| [17] |
Jiang H, Tian A, Jiang J. Intestinal stem cell response to injury: lessons from Drosophila. Cell Mol Life Sci, 2016, 73(17): 3337-3349.
pmid: 27137186 |
| [18] |
Johansson J, Naszai M, Hodder MC, Pickering KA, Miller BW, Ridgway RA, Yu Y, Peschard P, Brachmann S, Campbell AD, Cordero JB, Sansom OJ. RAL GTPases drive intestinal stem cell function and regeneration through internalization of WNT signalosomes. Cell Stem Cell, 2019, 24(4): 592-607.e7.
pmid: 30853556 |
| [19] |
Jiang H, Grenley MO, Bravo MJ, Blumhagen RZ, Edgar BA. EGFR/Ras/MAPK signaling mediates adult midgut epithelial homeostasis and regeneration in Drosophila. Cell Stem Cell, 2011, 8(1): 84-95.
pmid: 21167805 |
| [20] |
Wu Y, Yu L, Yu Y, Wu S, Yuan Q, Duan W, Cai S, Xiong B, Lin R, Guo Z. Drosophila and mouse intestinal stem cells are spatiotemporally specified by Notch suppression and Wnt activation. Sci Adv, 2025, 11(49): eady7272.
pmid: 41337595 |
| [21] |
Guo Z, Ohlstein B. Stem cell regulation. Bidirectional Notch signaling regulates Drosophila intestinal stem cell multipotency. Science, 2015, 350(6263): aab0988.
pmid: 26586765 |
| [22] |
Tian A, Benchabane H, Ahmed Y. Wingless/Wnt signaling in intestinal development, homeostasis, regeneration and tumorigenesis: a Drosophila perspective. J Dev Biol, 2018, 6(2): 8.
pmid: 29615557 |
| [23] |
Jiang H, Patel PH, Kohlmaier A, Grenley MO, McEwen DG, Edgar BA. Cytokine/Jak/Stat signaling mediates regeneration and homeostasis in the Drosophila midgut. Cell, 2009, 137(7): 1343-1355.
pmid: 19563763 |
| [24] |
Xu N, Wang SQ, Tan D, Gao YW, Lin G, Xi R. EGFR, Wingless and JAK/STAT signaling cooperatively maintain Drosophila intestinal stem cells. Dev Biol, 2011, 354(1): 31-43.
pmid: 21440535 |
| [25] |
Okamoto N, Watanabe A. Interorgan communication through peripherally derived peptide hormones in Drosophila. Fly (Austin), 2022, 16(1): 152-176.
pmid: 35499154 |
| [26] |
Tian L, Guo E, Wang S, Liu S, Jiang RJ, Cao Y, Ling E, Li S. Developmental regulation of glycolysis by 20-hydroxyecdysone and juvenile hormone in fat body tissues of the silkworm, Bombyx mori. J Mol Cell Biol, 2010, 2(5): 255-263.
pmid: 20729248 |
| [27] |
Ahmed SMH, Maldera JA, Krunic D, Paiva-Silva GO, Pénalva C, Teleman AA, Edgar BA. Fitness trade-offs incurred by ovary-to-gut steroid signalling in Drosophila. Nature, 2020, 584(7821): 415-419.
pmid: 32641829 |
| [28] |
Zipper L, Jassmann D, Burgmer S, Görlich B, Reiff T. Ecdysone steroid hormone remote controls intestinal stem cell fate decisions via the PPARγ-homolog Eip75B in Drosophila. eLife, 2020, 9: e55795.
pmid: 32773037 |
| [29] |
DiBello PR, Withers DA, Bayer CA, Fristrom JW, Guild GM. The Drosophila broad-complex encodes a family of related proteins containing zinc fingers. Genetics, 1991, 129(2): 385-397.
pmid: 1743483 |
| [30] |
Zeng X, Hou SX. Broad relays hormone signals to regulate stem cell differentiation in Drosophila midgut during metamorphosis. Development, 2012, 139(21): 3917-3925.
pmid: 23048182 |
| [31] |
Zhang S, Wu S, Yao R, Wei X, Ohlstein B, Guo Z. Eclosion muscles secrete ecdysteroids to initiate asymmetric intestinal stem cell division in Drosophila. Dev Cell, 2024, 59(1): 125-140.e12.
pmid: 38096823 |
| [32] |
Wang F, Qiao HH, Xu RG, Sun J, Zhu R, Mao D, Ni JQ. pNP transgenic RNAi system manual in Drosophila. Bio Protoc, 2019, 9(3): e3158.
pmid: 33654966 |
| [33] |
Ren X, Yang Z, Xu J, Sun J, Mao C, Hu Y, Yang SJ, Qiao HH, Wang X, Hu Q, Deng P, Liu LP, Ji JY, Li JB, Ni JQ. Enhanced specificity and efficiency of the CRISPR/Cas 9 system with optimized sgRNA parameters in Drosophila. Cell Rep, 2014, 9(3): 1151-1162.
pmid: 25437567 |
| [34] | Hu JL, Xi RW. A method for damage-induced regeneration of the intestinal epithelium in Drosophila. Bio-101, 2019, e1010303. |
| [35] |
Lin G, Xu N, Xi R. Paracrine Wingless signalling controls self-renewal of Drosophila intestinal stem cells. Nature, 2008, 455(7216): 1119-1123.
pmid: 18806781 |
| [36] |
Luo H, Rose P, Barber D, Hanratty WP, Lee S, Roberts TM, D'Andrea AD, Dearolf CR. Mutation in the Jak kinase JH2 domain hyperactivates Drosophila and mammalian Jak-Stat pathways. Mol Cell Biol, 1997, 17(3): 1562-1571.
pmid: 9032284 |
| [37] |
Reiff T, Jacobson J, Cognigni P, Antonello Z, Ballesta E, Tan KJ, Yew JY, Dominguez M, Miguel-Aliaga I. Endocrine remodelling of the adult intestine sustains reproduction in Drosophila. eLife, 2015, 4: e06930.
pmid: 26216039 |
| [38] |
Viragova S, Li D, Klein OD. Activation of fetal-like molecular programs during regeneration in the intestine and beyond. Cell Stem Cell, 2024, 31(7): 949-960.
pmid: 38971147 |
| [39] |
Zhang P, Edgar BA. Insect gut regeneration. Cold Spring Harb Perspect Biol, 2022, 14(2): a040915.
pmid: 34312250 |
| [40] |
Spokony RF, Restifo LL. Broad Complex isoforms have unique distributions during central nervous system metamorphosis in Drosophila melanogaster. J Comp Neurol, 2009, 517(1): 15-36.
pmid: 19711379 |
| [41] |
Uyehara CM, McKay DJ. Direct and widespread role for the nuclear receptor EcR in mediating the response to ecdysone in Drosophila. Proc Natl Acad Sci USA, 2019, 116(20): 9893-9902.
pmid: 31019084 |
| [1] | Shuyang Gao, Houguang Lu, Yanhua Wang, Dong Yan. Screening of Drosophila melanogaster RNA m6A modification pathway factors [J]. Hereditas(Beijing), 2025, 47(4): 476-488. |
| [2] | Yang Jian, Shi Guojuan, Peng Anghui, Xu Qingbo, Wang Ruiqi, Xue Lei, Yu Xinyang, Sun Yihao. Tip60-FOXO regulates JNK signaling mediated apoptosis in Drosophila [J]. Hereditas(Beijing), 2024, 46(6): 490-501. |
| [3] | Xiangyi Wei, Dongchun Hu, Zupeng Gao, Congjing Feng. JAK/STAT signaling pathway and its regulation on insect immunity [J]. Hereditas(Beijing), 2023, 45(3): 229-236. |
| [4] | Mengxiao Wang, Margaret S. Ho. Recent advances on the role of glia in physiological behaviors: insights from Drosophila melanogaster [J]. Hereditas(Beijing), 2022, 44(4): 300-312. |
| [5] | Zhilu Fan, Liyan Yang, Na Zhang, Dan Feng, Jing Guo, Chen Chang, Qing Yuan, Yan Cai, Yu Zhang, Wenqiang Wei, Mingrong Wang, Jiajie Hao. NEFL promotes invasion and migration of esophageal squamous carcinoma cells via the EGFR/AKT/S6 pathway [J]. Hereditas(Beijing), 2022, 44(4): 322-334. |
| [6] | Shuai Sun, Yuliang Deng. Single-cell detection of EGFR gene mutation in circulating tumor cells in lung cancer [J]. HEREDITAS(Beijing), 2015, 37(12): 1251-1257. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
www.chinagene.cn
备案号:京ICP备09063187号