Hereditas(Beijing) ›› 2024, Vol. 46 ›› Issue (11): 947-957.doi: 10.16288/j.yczz.24-181
• Research Article • Previous Articles Next Articles
Xiaojun Yang(), Zhenhan Huang, Wei Liu, Wenqing Zhang, Zhibin Huang(
)
Received:
2024-06-18
Revised:
2024-08-12
Online:
2024-11-20
Published:
2024-09-23
Contact:
Zhibin Huang
E-mail:2948225063@qq.com;huangzhb1986@scut.edu.cn
Supported by:
Xiaojun Yang, Zhenhan Huang, Wei Liu, Wenqing Zhang, Zhibin Huang. Identification and functional characterization of CD209 homologous genes in zebrafish[J]. Hereditas(Beijing), 2024, 46(11): 947-957.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
Amino acid sequence information of CD209 in different species"
物种 | 氨基酸序列号 |
---|---|
人(Homo sapiens) | NP_066978.1 |
黑猩猩(Pan troglodytes) | XP_063656223.1 |
小鼠(Mus musculus) | NP_573501.1 |
家牛(Bos taurus) | NP_001139228.1 |
孔雀鱼(Poecilia reticulata) | XP_017157862.1 |
鲤鱼(Cyprinus carpio) | XP_042588436.1 |
草鱼(Ctenopharyngodon idella) | QYY47516.1 |
斑马鱼zgc:174094(Danio rerio) | NP_001170922 |
斑马鱼cd209(Danio rerio) | NP_001186302.2 |
斑马鱼si:dkey-187i8.2(Danio rerio) | XP_021335897.1 |
Table 2
The information of genes and primers"
基因名称 | 引物序列(5'→3') |
---|---|
β-actin | F:GAGAGGTTTAGGTTGGTCGT R:GAGAGGTTTAGGTTGGTCGT |
ef1α | F:TACTTCTCAGGCTGACTGTG R:ATCTTCTTGATGTATGCGCT |
cd209l1 | F:GTTGCAGCTCAAGGATAAAGTCAC R:GTTCCTCAGCTGTGAGGATGATGG |
mfap4 | F:GTTTACACCATCTATCCAGCC R:GTTCTCTAGTCCCAGCCA |
il-1β | F:GTACTCAAGGAGATCAGCGG R:CTCGGTGTCTTTCCTGTCCA |
tnfα | F:GCGCTTTTCTGAATCCTACG R:TGCCCAGTCTGTCTCCTTCT |
il-8 | F:ATGACCAGCAAAATCATTTCAGTGTG R:TCATGGTTTTCTGTTGACAATGATCC |
irg1 | F:TGCTAGAAGAGCAGGACATCGC R:CAGTCCTTCAGCAGAGCTCAGA |
il-10 | F:TGTGCTCAGAGCAGGAGAGTCG R:GAGCTGTTGGCAGAATGGTCTCC |
tgfβ1b | F:ACTGGCTCTTGCTCCTATGTCTGG R:GGGTCTCAAGCACCTCAGTGTG |
arg2 | F:ATGGCGATGAGAGGACCACTG R:GATTGGCACGTCCAACTGTGC |
[1] |
Barton GM. A calculated response: control of inflammation by the innate immune system. J Clin Invest, 2008, 118(2): 413-420.
doi: 10.1172/JCI34431 pmid: 18246191 |
[2] | Bianchi ME. DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol, 2007, 81(1): 1-5. |
[3] |
Puig-Kröger A, Serrano-Gómez D, Caparrós E, Domínguez- Soto A, Relloso M, Colmenares M, Martínez-Muñoz L, Longo N, Sánchez-Sánchez N, Rincon M, Riva L, Sánchez-Mateos P, Fernández-Ruiz E, Corbí AL. Regulated expression of the pathogen receptor dendritic cell-specific intercellular adhesion molecule 3 (ICAM-3)- grabbing nonintegrin in THP-1 human leukemic cells, monocytes, and macrophages. J Biol Chem, 2004, 279(24): 25680-25688.
doi: 10.1074/jbc.M311516200 pmid: 15070901 |
[4] | Cheong C, Matos I, Choi JH, Dandamudi DB, Shrestha E, Longh MP, Jeffrey KL, Anthony RM, Kluger C, Nchinda G, Koh H, Rodriguez A, Idoyaga J, Pack M, Velinzon K, Park CG, Steinman RM. Microbial stimulation fully differentiates monocytes to DC-SIGN/CD209(+) dendritic cells for immune T cell areas. Cell, 2010, 143(3): 416-429. |
[5] |
Gringhuis SI, den Dunnen J, Litjens M, van Het Hof B, van Kooyk Y, Geijtenbeek TBH. C-type lectin DC-SIGN modulates Toll-like receptor signaling via Raf-1 kinase- dependent acetylation of transcription factor NF-kappaB. Immunity, 2007, 26(5): 605-616.
doi: 10.1016/j.immuni.2007.03.012 pmid: 17462920 |
[6] |
Yu T, Kuang HY, Chen JH, Lin X, Wu Y, Chen KY, Zhang MJ, Zhang WQ, Wen ZL. Tripartite-motif family protein 35-28 regulates microglia development by preventing necrotic death of microglial precursors in zebrafish. J Biol Chem, 2020, 295(26): 8846-8856.
doi: 10.1074/jbc.RA119.012043 pmid: 32398256 |
[7] |
Hall C, Flores MV, Storm T, Crosier K, Crosier P. The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev Biol, 2007, 7: 42.
pmid: 17477879 |
[8] |
Traver D, Paw BH, Poss KD, Penberthy WT, Lin S, Zon LI. Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nat Immunol, 2003, 4(12): 1238-1246.
pmid: 14608381 |
[9] |
Ma DY, Wang L, Wang SF, Gao Y, Wei YL, Liu F. Foxn1 maintains thymic epithelial cells to support T-cell development via mcm2 in zebrafish. Proc Natl Acad Sci USA, 2012, 109(51): 21040-21045.
doi: 10.1073/pnas.1217021110 pmid: 23213226 |
[10] | Madeira F, Pearce M, Tivey ARN, Basutkar P, Lee J, Edbali O, Madhusoodanan N, Kolesnikov A, Lopez R. Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Res, 2022, 50(W1): W276-W279. |
[11] | Westerfield M. The Zebrafish Book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. Eugene, OR: University of Oregon Press, 2000. |
[12] | Chitramuthu BP, Bennett HP. High resolution whole mount in situ hybridization within zebrafish embryos to study gene expression and function. J Vis Exp, 2013, (80): e50644. |
[13] | Lin AF, Xiang LX, Wang QL, Dong WR, Gong YF, Shao JZ. The DC-SIGN of zebrafish: insights into the existence of a CD209 homologue in a lower vertebrate and its involvement in adaptive immunity. J Immunol, 2009, 183(11): 7398-7410. |
[14] |
Bashirova AA, Geijtenbeek TB, van Duijnhoven GC, van Vliet SJ, Eilering JB, Martin MP, Wu L, Martin TD, Viebig N, Knolle PA, KewalRamani VN, van Kooyk Y, Carrington M. A dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN)- related protein is highly expressed on human liver sinusoidal endothelial cells and promotes HIV-1 infection. J Exp Med, 2001, 193(6): 671-678.
doi: 10.1084/jem.193.6.671 pmid: 11257134 |
[15] |
Kanaan R, Medlej-Hashim M, Jounblat R, Pilecki B, Sorensen GL. Microfibrillar-associated protein 4 in health and disease. Matrix Biol, 2022, 111: 1-25.
doi: 10.1016/j.matbio.2022.05.008 pmid: 35644509 |
[16] | Pilecki B, Kirketerp-Møller K L, Schlosser A, Kejling K, Dubik M, Madsen NP, Stubbe J, Hanse PBL, Andersen TL, Moeller JB, Marcussen N, Azevedo V, Hvidsten S, Baun C, Shi GP, Lindholt JS, Sorensen GL. MFAP4 deficiency attenuates angiotensin II-induced abdominal aortic aneurysm formation through regulation of macrophage infiltration and activity. Front Cardiovasc Med, 2021, 8: 764337. |
[17] |
Wentzel AS, Petit J, van Veen WG, Fin IR, Scheer MH, Piazzon MC, Forlenza M, Spaink HP, Wiegertjes GF. Transcriptome sequencing supports a conservation of macrophage polarization in fish. Sci Rep, 2020, 10(1): 13470.
doi: 10.1038/s41598-020-70248-y pmid: 32778701 |
[18] |
Sanderson LE, Chien AT, Astin JW, Crosier KE, Crosier PS, Hall CJ. An inducible transgene reports activation of macrophages in live zebrafish larvae. Dev Comp Immunol, 2015, 53(1): 63-69.
doi: 10.1016/j.dci.2015.06.013 pmid: 26123890 |
[19] | Novak ML, Koh TJ. Macrophage phenotypes during tissue repair. J Leukoc Biol. 2013, 93(6): 875-881. |
[20] |
Nathan CF, Hibbs JB Jr. Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr Opin Immunol, 1991, 3(1): 65-70.
doi: 10.1016/0952-7915(91)90079-g pmid: 1711326 |
[21] |
Rougeot J, Torraca V, Zakrzewska A, Kanwa Z, Jansen HJ, Somme F, Spain HP, Meijer AH. RNAseq profiling of leukocyte populations in zebrafish larvae reveals a cxcl11 chemokine gene as a marker of macrophage polarization during mycobacterial infection. Frontiers in immunology, 2019, 10: 832.
doi: 10.3389/fimmu.2019.00832 pmid: 31110502 |
[22] |
Ludwig IS, Geijtenbeek TBH, van Kooyk Y. Interactions of DC-SIGN with Mac-1 and CEACAM1 regulate contact between dendritic cells and neutrophils. FEBS Lett, 2005, 579(27): 6159-6168.
pmid: 16246332 |
[23] |
Yan SR, Sapru K, Issekutz AC. The CD11/CD18 (beta2) integrins modulate neutrophil caspase activation and survival following TNF-alpha or endotoxin induced transendothelial migration. Immunol Cell Biol, 2004, 82(4): 435-446.
pmid: 15283855 |
[24] |
Watson RW, Rotstein OD, Nathens AB, Parodo J, Marshall JC. Neutrophil apoptosis is modulated by endothelial transmigration and adhesion molecule engagement. J Immunol, 1997, 158(2): 945-953.
pmid: 8993015 |
[25] |
Coxon A, Rieu P, Barkalow FJ, Askari S, Sharp AH, von Andrian UH, Arnaou MA, Mayadas TN. A novel role for the beta 2 integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation. Immunity, 1996, 5(6): 653-666.
doi: 10.1016/s1074-7613(00)80278-2 pmid: 8986723 |
[26] |
Whitlock BB, Gardai S, Fadok V, Bratton D, Henson PM. Differential roles for alpha(M)beta(2) integrin clustering or activation in the control of apoptosis via regulation of akt and ERK survival mechanism. J Cell Biol, 2000, 151(6): 1305-1320.
doi: 10.1083/jcb.151.6.1305 pmid: 11121444 |
[27] |
Singer BB, Klaile E, Scheffrahn I, Müller MM, Kammerer R, Reutter W, Obrink B, Lucka L. CEACAM1 (CD66a) mediates delay of spontaneous and Fas ligand-induced apoptosis in granulocytes. Eur J Immunol, 2005, 35(6): 1949-1959.
doi: 10.1002/eji.200425691 pmid: 15909305 |
[28] |
Thomson J, Singh M, Eckersley A, Cain SA, Sherratt MJ, Baldoc C. Fibrillin microfibrils and elastic fibre proteins: functional interactions and extracellular regulation of growth factors. Semin Cell Dev Biol, 2019, 89: 109-117.
doi: S1084-9521(18)30018-1 pmid: 30016650 |
[29] |
Craft CS, Broekelmann TJ, Zou W, Chappel JC, Teitelbaum SL, Mecham RP. Oophorectomy-induced bone loss is attenuated in MAGP1-deficient mice. J Cell Biochem, 2012, 113(1): 93-99.
doi: 10.1002/jcb.23331 pmid: 21898536 |
[30] |
Brown S, Teo A, Pauklin S, Hannan N, Cho CH, Lim B, Vardy L, Dunn NR, Trotter M, Pedersen R, Vallier L. Activin/Nodal signaling controls divergent transcriptional networks in human embryonic stem cells and in endoderm progenitors. Stem Cells, 2011, 29(8): 1176-1185.
doi: 10.1002/stem.666 pmid: 21630377 |
[1] | Liu Jixiang, Lai Siting, Bai Jing, Xu Jin. Il34 rescues metronidazole-induced impairment of spinal cord regeneration in zebrafish central nervous system [J]. Hereditas(Beijing), 2024, 46(6): 478-489. |
[2] | Jiaxin Hong, Song’en Xu, Wenqing Zhang, Wei Liu. The interaction of Pu.1 and cMyb in zebrafish neutrophil development [J]. Hereditas(Beijing), 2024, 46(4): 319-332. |
[3] | Piao Sun, Ying Li, Fan Liu, Lu Wang. Generation and analysis of TPI deficiency zebrafish model [J]. Hereditas(Beijing), 2024, 46(3): 232-241. |
[4] | Kailun Li, Jingao Lu, Xiaohui Chen, Wenqing Zhang, Wei Liu. The role of the allantoin in promoting fracture healing in osteoclast-deficient zebrafish [J]. Hereditas(Beijing), 2023, 45(4): 341-353. |
[5] | Jing’ao Lu, Chunyan Huang, Zhiyin Lin, Zheng Tang, Ning Ma, Zhibin Huang. The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish [J]. Hereditas(Beijing), 2022, 44(9): 798-809. |
[6] | Pengfei Zheng, Haibo Xie, Panpan Zhu, Chengtian Zhao. Distribution pattern of floor plate neurons in zebrafish [J]. Hereditas(Beijing), 2022, 44(6): 510-520. |
[7] | Tingting Zhang, Feng Liu. Study on a detection method of protein tyrosine sulfation modification in zebrafish [J]. Hereditas(Beijing), 2022, 44(2): 178-186. |
[8] | Tingting Jia, Lei Lei, Xinyuan Wu, Shunyou Cai, Yixuan Chen, Yu Xue. Study on the mechanism of metformin on zebrafish skeletal development and damage repair [J]. Hereditas(Beijing), 2022, 44(1): 68-79. |
[9] | Jiani Guo, Fan Liu, Lu Wang. Zebrafish blood disease models and applications [J]. Hereditas(Beijing), 2020, 42(8): 725-738. |
[10] | Beibei Du, Lei Liu, Yangyang Zhu. RNA-binding protein Roquin negatively regulates STING-dependent innate immune response in Drosophila [J]. Hereditas(Beijing), 2020, 42(12): 1201-1210. |
[11] | Yu Huang,Siqi Hu,Fei Guo. Interaction between stress granules and viruses [J]. Hereditas(Beijing), 2019, 41(6): 494-508. |
[12] | Feng Xiong,Xunwei Xie,Luyuan Pan,Kuoyu Li,Liyue Liu,Yun Zhang,Linglu Li,Yonghua Sun. Development of resources, technologies and services at the China Zebrafish Resource Center [J]. Hereditas(Beijing), 2018, 40(8): 683-692. |
[13] | Xiumei Zhang, Jie Gao, Chunhong Chen, Haijun Tu. Progress in the mechanisms of neural modulation of innate immunity in Caenorhabditis elegans [J]. Hereditas(Beijing), 2018, 40(12): 1066-1074. |
[14] | Jingjin Xu, Wenjuan Zhang, Jingyi Wang, Liyun Yao, Yutian Pan, Yixin Ou, Yu Xue. The active component screening of Anoectochilus roxburghii and the functional study on inhibition of melanogenesis in zebrafish [J]. Hereditas(Beijing), 2017, 39(12): 1178-1187. |
[15] | Shanshan Liu, Cuizhen Zhang, Gang Peng. Effects of starvation on the expression of feeding related neuropeptides in the larval zebrafish hypothalamus [J]. Hereditas(Beijing), 2016, 38(9): 821-830. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
www.chinagene.cn
备案号:京ICP备09063187号