Mfn2减轻内质网应激抑制绵羊卵泡颗粒细胞凋亡的分子机制

doi:10.16288/j.yczz.24-247

[an error occurred while processing this directive]

Hereditas(Beijing) ›› 2025, Vol. 47 ›› Issue (3): 342-350.doi: 10.16288/j.yczz.24-247

• Research Article • Previous Articles Next Articles

Molecular mechanism of Mfn2 alleviating endoplasmic reticulum stress and inhibiting apoptosis of sheep follicular granulosa cells

Gulimire·Abudureyimu ¹(), Ying Chen¹, Shuhong Tang², Hong Dong³, Liqin Wang¹, Yangsheng Wu¹, Juncheng Huang³(), Jiapeng Lin¹()

1. Key Laboratory of Genetics Breeding and Reproduction of Grass Feeding Livestock, Ministry of Agriculture and Rural Affairs, Key Laboratory of Animal Biotechnology of Xinjiang, Institute of Biotechnology, Xinjiang Academy of Animal Sciences, Urumqi 830011, China
2. Akesu Region Animal Husbandry Technology Promotion Center, Aksu 843000, China
3. Institute of Animal Sciences, Xinjiang Academy of Animal Science, Urumqi 830011, China

Received:2024-08-23 Revised:2024-12-05 Online:2025-03-20 Published:2025-01-08
Contact: Juncheng Huang, Jiapeng Lin E-mail:gulimire127@163.com;h_jc@sina.com;linjiapeng5188@163.com
Supported by:
Xinjiang Uygur Autonomous Region Major Special Project(2023A02011-2);Xinjiang Uygur Autonomous Region Sheep Agriculture Research System Project(XJARS-09-08);Xinjiang Uygur Autonomous Region Three Rural Backbone Talent Training Project(2023SNGGNT031);Tianchi Talent Introduction Plan Project

Abstract

Abstract:

Follicle development is a crucial step in mammalian reproductive processes, the specific role of Mfn2 in regulating mitochondrial function and endoplasmic reticulum stress in this process is still unclear, this study aimed to investigate the role of Mfn2 in the follicular development of adult sheep. Large, medium, and small follicles were collected, and granulosa cells (GCs) were isolated from large follicles. The expression levels of Mfn2 in different follicles were detected using qRT-PCR and Western blot, and the localization of Mfn2 in follicles was determined through immunofluorescence. Additionally, the expression levels of the mitochondrial autophagy-related protein Pink1, endoplasmic reticulum stress proteins (Grp78, Perk, Chop), and apoptosis-related proteins (Bcl2 and BAX) were detected. Furthermore, siRNAs were transfected into GCs to knock down Mfn2 expression, and changes in intracellular Ca²⁺ accumulation and mitochondrial membrane potential were evaluated, along with the expression levels of the aforementioned proteins. The results showed that Mfn2 expression was significantly higher in large follicles compared to small follicles and was primarily localized in GCs. Compared to small follicles, the expression levels of Pink1, Grp78, Perk, Chop, and BAX were significantly lower in large follicles, while Bcl2 expression was significantly increased (P<0.01). After Mfn2 knockdown, intracellular Ca²⁺ levels and mitochondrial membrane potential were significantly reduced, while the expression levels of Pink1, Grp78, Perk, Chop, and BAX were significantly increased, and Bcl2 expression was significantly decreased (P<0.01). Mfn2 may influence cell apoptosis during sheep follicular development by regulating mitochondrial function and endoplasmic reticulum stress.

Key words: sheep follicles, granulosa cells, Mfn2, endoplasmic reticulum stress, cell apoptosis

Gulimire·Abudureyimu , Ying Chen, Shuhong Tang, Hong Dong, Liqin Wang, Yangsheng Wu, Juncheng Huang, Jiapeng Lin. Molecular mechanism of Mfn2 alleviating endoplasmic reticulum stress and inhibiting apoptosis of sheep follicular granulosa cells[J]. Hereditas(Beijing), 2025, 47(3): 342-350.

Figures/Tables 7

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

References 20

[1]	Telfer EE, Grosbois J, Odey YL, Rosario R, Anderson RA. Making a good egg: human oocyte health, aging, and in vitro development. Physiol Rev, 2023, 103(4): 2623-2677.
[2]	Chen XH, He HZ, Long BC, Wei BL, Yang P, Huang XY, Wang Q, Lin J, Tang HL. Acupuncture regulates the apoptosis of ovarian granulosa cells in polycystic ovarian syndrome-related abnormal follicular development through LncMEG3-mediated inhibition of miR-21-3p. Biol Res, 2023, 56(1): 31. doi: 10.1186/s40659-023-00441-6 pmid: 37303036
[3]	Arslan NP, Taskin M, Keles ON. Nicotinamide mononucleotide and nicotinamide riboside reverse ovarian aging in rats via rebalancing mitochondrial fission and fusion mechanisms. Pharm Res, 2024, 41(6): 921-935.
[4]	Wang ZH, Wang ZJ, Liu HC, Wang CY, Wang YQ, Yue Y, Zhao C, Wang GY, Wan JP. Targeting mitochondria for ovarian aging: new insights into mechanisms and therapeutic potential. Front Endocrinol (Lausanne), 2024, 15: 1417007.
[5]	Liao XH, Zhu SQ, Qiu SM, Cao H, Jiang WW, Xu HL, Sun Y, Zheng BH. Mfn2 regulates mitochondria-associated ER membranes to affect PCOS oocyte development. Endocr Connect, 2024, 13(1): e230343.
[6]	Basha EH, Eltokhy AKB, Eltantawy AF, Heabah NAE, Elshwaikh SL, El-Harty YM. Linking mitochondrial dynamics and fertility: promoting fertility by phoenixin through modulation of ovarian expression of GnRH receptor and mitochondrial dynamics proteins DRP-1 and Mfn-2. Pflugers Arch, 2022, 474(10): 1107-1119.
[7]	Liu WJ, Li LS, Lan MF, Shang JZ, Zhang JX, Xiong WJ, Lai XL, Duan X. Zinc deficiency deteriorates ovarian follicle development and function by inhibiting mitochondrial function. J Ovarian Res, 2024, 17(1): 115.
[8]	Zhu MK, Yan M, Chen JF, Li HY, Zhang YS. MicroRNA- 129-1-3p attenuates autophagy-dependent cell death by targeting MCU in granulosa cells of laying hens under H₂O₂-induced oxidative stress. Poult Sci, 2023, 102(10): 103006.
[9]	Esencan E, Beroukhim G, Seifer DB. Age-related changes in folliculogenesis and potential modifiers to improve fertility outcomes—a narrative review. Reprod Biol Endocrinol, 2022, 20(1): 156.
[10]	Wang TR, Xiao Y, Hu Z, Gu JK, Hua RW, Hai Z, Chen XL, Zhang JV, Yu ZY, Wu T, Yeung WSB, Liu K, Guo CX. MFN2 deficiency impairs mitochondrial functions and PPAR pathway during spermatogenesis and meiosis in mice. Front Cell Dev Biol, 2022, 10: 862506.
[11]	Xie CC, Lu H, Zhang XJ, An Z, Chen T, Yu WB, Wang SS, Shang DD, Wang XY. Mitochondrial abnormality in ovarian granulosa cells of patients with polycystic ovary syndrome. Mol Med Rep, 2024, 29(2): 27.
[12]	Paula VG, Sinzato YK, Gallego FQ, Cruz LL, de Aquino AM, Scarano WR, Corrente JE, Volpato GT, Damasceno DC. Intergenerational hyperglycemia impairs mitochondrial function and follicular development and causes oxidative stress in rat ovaries independent of the consumption of a high-fat diet. Nutrients, 2023, 15(20): 4407.
[13]	Yang C, Luo P, Yang YT, Fu XL, Li BX, Shen X, Xu DN, Huang YM, Tian YB, Liu WJ. Drp1 regulated PINK1- dependent mitophagy protected duck follicular granulosa cells from acute heat stress injury. Poult Sci, 2024, 103(1): 103247.
[14]	Martinez A, Lamaizon CM, Valls C, Llambi F, Leal N, Fitzgerald P, Guy C, Kamiński MM, Inestrosa NC, van Zundert B, Cancino GI, Dulcey AE, Zanlungo S, Marugan JJ, Hetz C, Green DR, Alvarez AR. c-Abl phosphorylates MFN2 to regulate mitochondrial morphology in cells under endoplasmic reticulum and oxidative stress, impacting cell survival and neurodegeneration. Antioxidants (Basel), 2023, 12(11): 2007.
[15]	Olaniyi KS, Areloegbe SE. Acetate ameliorates ovarian mitochondrial dysfunction in letrozole-induced polycystic ovarian syndrome rat model by improving mitofusin-2. J Physiol Sci, 2024, 74(1): 22. doi: 10.1186/s12576-024-00908-5 pmid: 38561673
[16]	Wang S, Sang XH, Li SH, Yang WJ, Wang SH, Chen HX, Lu C. Increased Ca²⁺ transport across the mitochondria- associated membranes by Mfn2 inhibiting endoplasmic reticulum stress in ischemia/reperfusion kidney injury. Sci Rep, 2023, 13(1): 17257.
[17]	Chen XY, Shi CR, He MH, Xiong SQ, Xia XB. Endoplasmic reticulum stress: molecular mechanism and therapeutic targets. Signal Transduct Target Ther, 2023, 8(1): 352.
[18]	Lounas A, Breton Y, Lebrun A, Laflamme I, Vernoux N, Savage J, Tremblay MÈ, Pelletier M, Germain M, Richard FJ. The follicle-stimulating hormone triggers rapid changes in mitochondrial structure and function in porcine cumulus cells. Sci Rep, 2024, 14(1): 436.
[19]	Ju WH, Zhao YW, Yu Y, Zhao S, Xiang S, Lian F. Mechanisms of mitochondrial dysfunction in ovarian aging and potential interventions. Front Endocrinol (Lausanne), 2024, 15: 1361289.
[20]	Zhang M, Bener MB, Jiang ZL, Wang TR, Esencan E, Scott R, Horvath T, Seli E. Mitofusin 2 plays a role in oocyte and follicle development, and is required to maintain ovarian follicular reserve during reproductive aging. Aging (Albany NY), 2019, 11(12): 3919-3938.

Metrics

Comments

www.chinagene.cn
备案号：京ICP备09063187号

基因	引物序列(5′→3′)	产物大小(bp)
Mfn2	F: TGGGAGGCTAGGAAGGTGAA	125
Mfn2	R: TCATGAACATGGGCTGGGTC	125
Grp78	F: TCACCTCCAATCCGGAGAAC	78
Grp78	R: CTTTGTTTGCCCACCTCCAA	78
Pink1	F: TTTAGCGCAATGAGCCAGGA	131
Pink1	R: ACCCGGATGATGTTGGGATG	131
Perk	F: GCAGTGGCAATGAGAAGTGG	200
Perk	R: CCAATCTGCAACGGAGACCT	200
Chop	F: GCAGCGACAGAGCCAAAATC	98
Chop	R: TCAGGCTCTGCTTTCAGGTG	98
β-actin	F: ATCGGCAATGAGCGGTTCC	108
β-actin	R: CGTGTTGGCGTAGAGGTCTT	108

Molecular mechanism of Mfn2 alleviating endoplasmic reticulum stress and inhibiting apoptosis of sheep follicular granulosa cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 20

Related Articles 6

Recommended Articles

Metrics

Comments

[1]	Tonglu YU,Dongliang Cai,Genfeng Zhu,Xiaojuan Ye,Taishan Min,Hongyan Chen,Daru Lu,Haoming Chen. Effects of CSN4 knockdown on proliferation and apoptosis of breast cancer MDA-MB-231 cells [J]. Hereditas(Beijing), 2019, 41(4): 318-326.
[2]	Xinyu Yang,Zhenwei Jia. The role of EGF-like factor signaling pathway in granulosa cells in regulation of oocyte maturation and development [J]. Hereditas(Beijing), 2019, 41(2): 137-145.
[3]	Jianyuan Zhao, Jiwei Ding, Zeyun Mi, Jinming Zhou, Tao Wei, Shan Cen. Genetic variance in the HIV-1 founder virus Vpr affects its ability to induce cell cycle G₂ arrest and cell apoptosis [J]. HEREDITAS(Beijing), 2015, 37(5): 480-486.
[4]	GUO Fen, LUO Zhi-Wen, LIU Zhao-Yu, LI Ru-Qin, LI Hong-Jian, ZHOU Tian-Hong. Studies of effect of prosaposin on cell proliferation, cell apoptosis and its possible molecular mechanism [J]. HEREDITAS, 2009, 31(12): 1226-1232.
[5]	FU Hao, ZHAO Dan-Yi, SUN Xiu-Ju, HUA Jun, YAN Yang, QIU Guang-Rong, SHANG Chao, FU Wei-Neng, SUN. Effect of B-RAF-specific RNA interference on gastric cancer BGC823 cell line [J]. HEREDITAS, 2007, 29(5): 537-537―540.
[6]	WANG Lin, LIANG Xu-Fang, LIAO Wan-Qin, ZHOU Tian-Hong. Research Progress on Cell Apoptosis in Embryonic Development of Zebrafish (Danio rerio) [J]. HEREDITAS, 2006, 28(8): 1009-1014.