Hereditas(Beijing) ›› 2025, Vol. 47 ›› Issue (5): 573-588.doi: 10.16288/j.yczz.24-288
• Research Article • Previous Articles Next Articles
Jiehao Lin(), Tongshu Yang, Wenqing Zhang(
), Wei Liu(
)
Received:
2024-10-08
Revised:
2024-12-11
Online:
2025-04-25
Published:
2025-02-18
Contact:
Wenqing Zhang, Wei Liu
E-mail:2213763056@qq.com;mczhangwq@scut.edu.cn;liuwei7@scut.edu.cn
Supported by:
Jiehao Lin, Tongshu Yang, Wenqing Zhang, Wei Liu. Role of different Lyl1 transcripts in zebrafish primitive hematopoiesis[J]. Hereditas(Beijing), 2025, 47(5): 573-588.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
The primer sequences used in this study"
引物名称 | 引物序列(5′→3′) | 用途 |
---|---|---|
qPCR1 | F:CATCTCCATCTGTCCTCCAGC R:TGTGTCCTGAGCTCTGGGTT | 荧光定量PCR |
qPCR2 | F:GCTGAGCAAGAACGAGATCCT R:CTGTCAGTGTCCCCATAGCAG | |
mfap4 | F:GTTTACACCATCTATCCAGCC R:GTTCTCTAGTCCCAGCCA | |
lyz | F:AAAGCAGGTTTAAGACCCAC R:CTGTCAGTGTCCCCATAGCAG | |
gata1a | F:TCCAGTTCGCCAAGTTTACTCA R:GGAGGTGTGAGAGTGGAGAGGT | |
βe1 | F:CTGGCAAGGTGTCTCATCG R:GCAGCACACTTAAATCAGCA | |
alas2 | F:AGGAGAGCCCATCAGAGAAATG R:TTATCGCCTGCACGTAGATGTT | |
z_GSP | GATTACGCCAAGCTTCCGGCGGGTGCGTCGGGATCAGT | 5′RACE |
h_GSP | GATTACGCCAAGCTTCGTCGGCAGCAGCTTCCTCAGCT | |
FP1 | F:AGAACCCAGAGCTCAGGACA | PCR |
RP1 | R:AGCGTTACTGAAGATCCCGA | |
FP2 | F:CCCAGCACACGCGTGTTCAA | |
RP2 | R:GGCAGAGATGCGGAGCTGGA |
[1] |
Davidson AJ, Zon LI. Turning mesoderm into blood: the formation of hematopoietic stem cells during embryogenesis. Curr Top Dev Biol, 2000, 50: 45-60.
pmid: 10948449 |
[2] |
Zizioli D, Mione M, Varinelli M, Malagola M, Bernardi S, Alghisi E, Borsani G, Finazzi D, Monti E, Presta M, Russo D. Zebrafish disease models in hematology: highlights on biological and translational impact. Biochim Biophys Acta Mol Basis Dis, 2019, 1865(3): 620-633.
pmid: 30593895 |
[3] |
Ciau-Uitz A, Monteiro R, Kirmizitas A, Patient R. Developmental hematopoiesis: ontogeny, genetic programming and conservation. Exp Hematol, 2014, 42(8): 669-683.
pmid: 24950425 |
[4] |
Canu G, Ruhrberg C. First blood: the endothelial origins of hematopoietic progenitors. Angiogenesis, 2021, 24(2): 199-211.
pmid: 33783643 |
[5] |
Palis J. Erythropoiesis in the mammalian embryo. Exp Hematol, 2024, 136: 104283.
pmid: 39048071 |
[6] |
Bertrand JY, Kim AD, Violette EP, Stachura DL, Cisson JL, Traver D. Definitive hematopoiesis initiates through a committed erythromyeloid progenitor in the zebrafish embryo. Development, 2007, 134(23): 4147-4156.
pmid: 17959717 |
[7] |
Moore MA, Metcalf D. Ontogeny of the haemopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br J Haematol, 1970, 18(3): 279-296.
pmid: 5491581 |
[8] |
Goldfarb AN, Lewandowska K. Inhibition of cellular differentiation by the SCL/tal oncoprotein: transcriptional repression by an Id-like mechanism. Blood, 1995, 85(2): 465-471.
pmid: 7812000 |
[9] |
Hofmann TJ, Cole MD. The TAL1/Scl basic helix-loop- helix protein blocks myogenic differentiation and E-box dependent transactivation. Oncogene, 1996, 13(3): 617-624.
pmid: 8760303 |
[10] |
Hsu HL, Wadman I, Tsan JT, Baer R. Positive and negative transcriptional control by the TAL1 helix-loop- helix protein. Proc Natl Acad Sci USA, 1994, 91(13): 5947-5951.
pmid: 8016094 |
[11] |
Wadman IA, Osada H, Grütz GG, Agulnick AD, Westphal H, Forster A, Rabbitts TH. The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J, 1997, 16(11): 3145-3157.
pmid: 9214632 |
[12] |
Hoang T, Lambert JA, Martin R. SCL/TAL1 in hematopoiesis and cellular reprogramming. Curr Top Dev Biol, 2016, 118: 163-204.
pmid: 27137657 |
[13] |
Real PJ, Ligero G, Ayllon V, Ramos-Mejia V, Bueno C, Gutierrez-Aranda I, Navarro-Montero O, Lako M, Menendez P. SCL/TAL1 regulates hematopoietic specification from human embryonic stem cells. Mol Ther, 2012, 20(7): 1443-1453.
pmid: 22491213 |
[14] |
Lukov GL, Goodell MA. LYL1 degradation by the proteasome is directed by a N-terminal PEST rich site in a phosphorylation-independent manner. PLoS One, 2010, 5(9): e12692.
pmid: 20844761 |
[15] |
Giroux S, Kaushik AL, Capron C, Jalil A, Kelaidi C, Sablitzky F, Dumenil D, Albagli O, Godin I. lyl-1 and tal-1/scl, two genes encoding closely related bHLH transcription factors, display highly overlapping expression patterns during cardiovascular and hematopoietic ontogeny. Gene Expr Patterns, 2007, 7(3): 215-226.
pmid: 17112790 |
[16] |
Visvader J, Begley CG, Adams JM. Differential expression of the LYL, SCL and E2A helix-loop-helix genes within the hemopoietic system. Oncogene, 1991, 6(2): 187-194.
pmid: 2000219 |
[17] |
Chiu SK, Orive SL, Moon MJ, Saw J, Ellis S, Kile BT, Huang YZ, Chacon D, Pimanda JE, Beck D, Hamilton JR, Tremblay CS, Curtis DJ. Shared roles for Scl and Lyl1 in murine platelet production and function. Blood, 2019, 134(10): 826-835.
pmid: 31300405 |
[18] |
Kuo SS, Mellentin JD, Copeland NG, Gilbert DJ, Jenkins NA, Cleary ML. Structure, chromosome mapping, and expression of the mouse Lyl-1 gene. Oncogene, 1991, 6(6): 961-968.
pmid: 2067848 |
[19] |
Capron C, Lécluse Y, Kaushik AL, Foudi A, Lacout C, Sekkai D, Godin I, Albagli O, Poullion I, Svinartchouk F, Schanze E, Vainchenker W, Sablitzky F, Bennaceur- Griscelli A, Duménil D. The SCL relative LYL-1 is required for fetal and adult hematopoietic stem cell function and B-cell differentiation. Blood, 2006, 107(12): 4678-4686.
pmid: 16514064 |
[20] |
Capron C, Lacout C, Lécluse Y, Wagner-Ballon O, Kaushik AL, Cramer-Bordé E, Sablitzky F, Duménil D, Vainchenker W. LYL-1 deficiency induces a stress erythropoiesis. Exp Hematol, 2011, 39(6): 629-642.
pmid: 21420467 |
[21] |
Chan WYI, Follows GA, Lacaud G, Pimanda JE, Landry JR, Kinston S, Knezevic K, Piltz S, Donaldson IJ, Gambardella L, Sablitzky F, Green AR, Kouskoff V, Göttgens B. The paralogous hematopoietic regulators Lyl1 and Scl are coregulated by Ets and GATA factors, but Lyl1 cannot rescue the early Scl-/- phenotype. Blood, 2007, 109(5): 1908-1916.
pmid: 17053063 |
[22] |
Wang ST, Ren DS, Arkoun B, Kaushik AL, Matherat G, Lécluse Y, Filipp D, Vainchenker W, Raslova H, Plo I, Godin I. Lyl-1 regulates primitive macrophages and microglia development. Commun Biol, 2021, 4(1): 1382.
pmid: 34887504 |
[23] |
Zhou ZY, Huang B, Li S, Huang XH, Tang JY, Kwan YW, Hoi PM, Lee SMY. Sodium tanshinone IIA sulfonate promotes endothelial integrity via regulating VE-cadherin dynamics and RhoA/ROCK-mediated cellular contractility and prevents atorvastatin-induced intracerebral hemorrhage in zebrafish. Toxicol Appl Pharmacol, 2018, 350: 32-42.
pmid: 29730311 |
[24] |
Hall C, Flores MV, Storm T, Crosier K, Crosier P. The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev Biol, 2007, 7: 42.
pmid: 17477879 |
[25] |
Mazzolini J, Chia K, Sieger D. Isolation and RNA extraction of neurons, macrophages and microglia fromlarval zebrafish brains. J Vis Exp, 2018, (134): 57431.
pmid: 29757273 |
[26] | Westerfield M. The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press, Eugene, 1995. |
[27] |
Thisse C, Thisse B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat Protoc, 2008, 3(1): 59-69.
pmid: 18193022 |
[28] |
Songhet P, Adzic D, Reibe S, Rohr KB. fgf1 is required for normal differentiation of erythrocytes in zebrafish primitive hematopoiesis. Dev Dyn, 2007, 236(3): 633-643.
pmid: 17219402 |
[29] |
Kitaguchi T, Kawakami K, Kawahara A. Transcriptional regulation of a myeloid-lineage specific gene lysozyme C during zebrafish myelopoiesis. Mech Dev, 2009, 126(5-6): 314-323.
pmid: 19275935 |
[30] |
Li XG, Xiong JW, Shelley CS, Park H, Arnaout MA. The transcription factor ZBP-89 controls generation of the hematopoietic lineage in zebrafish and mouse embryonic stem cells. Development, 2006, 133(18): 3641-3650.
pmid: 16914492 |
[31] |
Li JY, Li K, Dong XH, Liang D, Zhao QS. Ncor1 and Ncor2 play essential but distinct roles in zebrafish primitive myelopoiesis. Dev Dyn, 2014, 243(12): 1544-1553.
pmid: 25156564 |
[32] |
Chang NN, Sun CH, Gao L, Zhu D, Xu XF, Zhu XJ, Xiong JW, Xi JZJ. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res, 2013, 23(4): 465-472.
pmid: 23528705 |
[33] | Hong JX, Xu SE, Zhang WQ, Liu W. The interaction of Pu.1 and cMyb in zebrafish neutrophil development. Hereditas(Beijing), 2024, 46(4): 319-332. |
洪佳馨, 徐颂恩, 张文清, 刘伟. Pu.1和cMyb在斑马鱼中性粒细胞发育中的相互作用. 遗传, 2024, 46(4): 319-332. | |
[34] |
Pavani G, Klein JG, Nations CC, Sussman JH, Tan K, An HH, Abdulmalik O, Thom CS, Gearhart PA, Willett CM, Maguire JA, Chou ST, French DL, Gadue P. Modeling primitive and definitive erythropoiesis with induced pluripotent stem cells. Blood Adv, 2024, 8(6): 1449-1463.
pmid: 38290102 |
[35] |
Liu C, Li R, Li Y, Lin XM, Zhao KC, Liu Q, Wang SW, Yang XQ, Shi XY, Ma YT, Pei CY, Wang H, Bao WD, Hui JH, Yang T, Xu ZC, Lai TT, Berberoglu MA, Sahu SK, Esteban MA, Ma KL, Fan GY, Li YX, Liu SP, Chen A, Xu X, Dong ZQ, Liu LQ. Spatiotemporal mapping of gene expression landscapes and developmental trajectories during zebrafish embryogenesis. Dev Cell, 2022, 57(10): 1284-1298.e5.
pmid: 35512701 |
[36] |
Farnsworth DR, Saunders LM, Miller AC. A single-cell transcriptome atlas for zebrafish development. Dev Biol, 2020, 459(2): 100-108.
pmid: 31782996 |
[37] |
Yang SY, Cao SH, Xu XB, Li Q, Li JT, Guo J, Wang F, Bao YH, Jiang ZA, Zhang T, Wang L, Sun SG. adducin 1 is essential for the survival of erythroid precursors via regulating p53 transcription in zebrafish. iScience, 2023, 26(9): 107516.
pmid: 37636049 |
[38] |
Qian F, Zhen FH, Xu J, Huang M, Li WY, Wen ZL. Distinct functions for different scl isoforms in zebrafish primitive and definitive hematopoiesis. PLoS Biol, 2007, 5(5): e132.
pmid: 17472439 |
[39] |
Ren X, Gomez GA, Zhang B, Lin S. Scl isoforms act downstream of etsrp to specify angioblasts and definitive hematopoietic stem cells. Blood, 2010, 115(26): 5338-5346.
pmid: 20185582 |
[40] |
Zhen FH, Lan YH, Yan B, Zhang WQ, Wen ZL. Hemogenic endothelium specification and hematopoietic stem cell maintenance employ distinct Scl isoforms. Development, 2013, 140(19): 3977-3985.
pmid: 24046317 |
[1] | Liu Jixiang, Lai Siting, Bai Jing, Xu Jin. Il34 rescues metronidazole-induced impairment of spinal cord regeneration in zebrafish central nervous system [J]. Hereditas(Beijing), 2024, 46(6): 478-489. |
[2] | Jiaxin Hong, Song’en Xu, Wenqing Zhang, Wei Liu. The interaction of Pu.1 and cMyb in zebrafish neutrophil development [J]. Hereditas(Beijing), 2024, 46(4): 319-332. |
[3] | Piao Sun, Ying Li, Fan Liu, Lu Wang. Generation and analysis of TPI deficiency zebrafish model [J]. Hereditas(Beijing), 2024, 46(3): 232-241. |
[4] | Xiaojun Yang, Zhenhan Huang, Wei Liu, Wenqing Zhang, Zhibin Huang. Identification and functional characterization of CD209 homologous genes in zebrafish [J]. Hereditas(Beijing), 2024, 46(11): 947-957. |
[5] | Kailun Li, Jingao Lu, Xiaohui Chen, Wenqing Zhang, Wei Liu. The role of the allantoin in promoting fracture healing in osteoclast-deficient zebrafish [J]. Hereditas(Beijing), 2023, 45(4): 341-353. |
[6] | Jing’ao Lu, Chunyan Huang, Zhiyin Lin, Zheng Tang, Ning Ma, Zhibin Huang. The role of the cd99l2 gene on leukocyte interstitial migration in zebrafish [J]. Hereditas(Beijing), 2022, 44(9): 798-809. |
[7] | Fengyu Sun, Qianghua Xu. Research progress of microRNAs involved in hematopoiesis [J]. Hereditas(Beijing), 2022, 44(9): 756-771. |
[8] | Rongrong Mu, Qingqing Niu, Yuqiang Sun, Jun Mei, Meng Miao. Cloning and characterization of the MYB transcription factor gene GhTT2 in Gossypium hirsutum [J]. Hereditas(Beijing), 2022, 44(8): 720-728. |
[9] | Pengfei Zheng, Haibo Xie, Panpan Zhu, Chengtian Zhao. Distribution pattern of floor plate neurons in zebrafish [J]. Hereditas(Beijing), 2022, 44(6): 510-520. |
[10] | Tingting Zhang, Feng Liu. Study on a detection method of protein tyrosine sulfation modification in zebrafish [J]. Hereditas(Beijing), 2022, 44(2): 178-186. |
[11] | Tingting Jia, Lei Lei, Xinyuan Wu, Shunyou Cai, Yixuan Chen, Yu Xue. Study on the mechanism of metformin on zebrafish skeletal development and damage repair [J]. Hereditas(Beijing), 2022, 44(1): 68-79. |
[12] | Menggang Lv, Aijia Liu, Qingwei Li, Peng Su. Progress on the origin, function and evolutionary mechanism of RHR transcription factor family [J]. Hereditas(Beijing), 2021, 43(3): 215-225. |
[13] | Xiaofen Qiu, Dong’e Tang, Haiyan Yu, Qiuyan Liao, Zhiyang Hu, Jun Zhou, Xin Zhao, Huiyan He, Zhuojian Liang, Chengming Xu, Ming Yang, Yong Dai. Analysis of transcription factors in accessible open chromatin in the 18-trisomy syndrome based on single cell ATAC sequencing technique [J]. Hereditas(Beijing), 2021, 43(1): 74-83. |
[14] | Xiaomei Tuo, Dongli Zhu, Xiaofeng Chen, Yu Rong, Yan Guo, Tielin Yang. The osteoporosis susceptible SNP rs4325274 remotely regulates the SOX6 gene through enhancers [J]. Hereditas(Beijing), 2020, 42(9): 889-897. |
[15] | Jiani Guo, Fan Liu, Lu Wang. Zebrafish blood disease models and applications [J]. Hereditas(Beijing), 2020, 42(8): 725-738. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
www.chinagene.cn
备案号:京ICP备09063187号