利用谱系追踪方法探究Lgr5在胰腺组织及其类器官中的表达

doi:10.16288/j.yczz.22-022

[an error occurred while processing this directive]

Hereditas(Beijing) ›› 2022, Vol. 44 ›› Issue (5): 432-441.doi: 10.16288/j.yczz.22-022

• Research Article • Previous Articles Next Articles

Study on Lgr5 expression in pancreas tissues and organoids by lineage tracing

Bingru Yan¹(), Xianhui Ai¹, Miao Liu¹, Lihong Tian², Yang Liang¹, Chun-Bo Teng¹()

1. College of Life Science, Northeast Forestry University, Harbin 150040, China
2. College of Wildlife and Protected Area, Northeast Forestry University, Harbin 150040, China

Received:2022-01-26 Revised:2022-03-26 Online:2022-05-20 Published:2022-04-18
Contact: Teng Chun-Bo E-mail:heylr5553@163.com;chunboteng@nefu.edu.cn
Supported by:
Supported by the National Natural Science Foundation of China(32072801)

Abstract

Abstract:

Leucine rich repeat containing G protein-coupled receptor 5(Lgr5) is widely expressed in multiple tissues and can be used as a stem cell marker in a variety of epithelial organs (including the small intestine, colon, stomach and hair follicles). In this study, we used Lgr5-Cre^ERT2+/- and Rosa26-mTmG hybridized transgenic mice to investigate the expression of Lgr5 in both ductal epithelial cells during pancreas development and in vitro cultured pancreatic duct organoids. After induction with Tamoxifen, the Lgr5 expression was analyzed by detecting the enhanced green fluorescence protein in the pancreatic tissue sections in adult animals and embryos at different developmental stages. The results showed that Lgr5 expression was detected neither in adult pancreatic duct epithelia nor in the embryonic pancreatic tissues at day 15.5 or in newborn mice. However, when 4-hydroxy-Tamoxifen was supplemented to the culture medium, EGFP could be detected in the primary pancreatic duct organoids from Lgr5-Cre ^ERT2+/-; Rosa26-mTmG mice. These results suggested that Lgr5 was not expressed in adult and embryonic pancreatic tissues; but could be expressed in the cultured pancreas ductal organoids. The research lays the foundation for exploring specific gene expression patterns in stem/progenitor cells during pancreatic development.

Key words: pancreas, duct, Lgr5, organoid, lineage tracing

Bingru Yan, Xianhui Ai, Miao Liu, Lihong Tian, Yang Liang, Chun-Bo Teng. Study on Lgr5 expression in pancreas tissues and organoids by lineage tracing[J]. Hereditas(Beijing), 2022, 44(5): 432-441.

Figures/Tables 8

Fig. 1

Table 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

References 28

[1]	Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A, Korving J, Begthel H, Peters PJ, Clevers H. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature, 2007, 449(7165):1003-1007. doi: 10.1038/nature06196
[2]	Koo BK, Clevers H. Stem cells marked by the R-spondin receptor LGR5. Gastroenterology, 2014, 147(2):289-302. doi: 10.1053/j.gastro.2014.05.007
[3]	Nagano K. R-spondin signaling as a pivotal regulator of tissue development and homeostasis. Jpn Dent Sci Rev, 2019, 55(1):80-87. doi: 10.1016/j.jdsr.2019.03.001
[4]	Cardinale V, Wang YF, Carpino G, Mendel G, Alpini G, Gaudio E, Reid LM, Alvaro D. The biliary tree--a reservoir of multipotent stem cells. Nat Rev Gastroenterol Hepatol, 2012, 9(4):231-240. doi: 10.1038/nrgastro.2012.23 pmid: 22371217
[5]	Zaret KS, Grompe M. Generation and regeneration of cells of the liver and pancreas. Science, 2008, 322(5907):1490-1494. doi: 10.1126/science.1161431
[6]	Slack JM. Developmental biology of the pancreas. Development, 1995, 121(6):1569-1580. pmid: 7600975
[7]	Gu G, Dubauskaite J, Melton DA. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development, 2002, 129(10):2447-2457. doi: 10.1242/dev.129.10.2447
[8]	Wang YF, Lanzoni G, Carpino G, Cui CB, Dominguez- Bendala J, Wauthier E, Cardinale V, Oikawa T, Pileggi A, Gerber D, Furth ME, Alvaro D, Gaudio E, Inverardi L, Reid LM. Biliary tree stem cells, precursors to pancreatic committed progenitors: evidence for possible life-long pancreatic organogenesis. Stem Cells, 2013, 31(9):1966-1979. doi: 10.1002/stem.1460
[9]	Huch M, Gehart H, van Boxtel R, Hamer K, Blokzijl F, Verstegen MMA, Ellis E, van Wenum M, Fuchs SA, de Ligt J, van de Wetering M, Sasaki N, Boers SJ, Kemperman H, de Jonge J, Ijzermans JN, Nieuwenhuis EE, Hoekstra R, Strom S, Vries RR, van der Laan LJ, Cuppen E, Clevers H. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell, 2015, 160(1-2):299-312. doi: 10.1016/j.cell.2014.11.050
[10]	Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR, Lein ES, Zeng HK. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci, 2010, 13(1):133-140. doi: 10.1038/nn.2467 pmid: 20023653
[11]	Sohal DS, Nghiem M, Crackower MA, Witt SA, Kimball TR, Tymitz KM, Penninger JM, Molkentin JD. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res, 2001, 89(1):20-25. pmid: 11440973
[12]	Barker N, Huch M, Kujala P, van de Wetering M, Snippert HJ, van Es JH, Sato T, Stange DE, Begthel H, van den Born M, Danenberg E, van den Brink S, Korving J, Abo A, Peters PJ, Wright N, Poulsom R, Clevers H. Lgr5^+ve stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell, 2010, 6(1):25-36. doi: 10.1016/j.stem.2009.11.013 pmid: 20085740
[13]	Jaks V, Barker N, Kasper M, van Es JH, Snippert HJ, Clevers H, Toftgård R. Lgr5 marks cycling, yet long-lived, hair follicle stem cells. Nat Genet, 2008, 40(11):1291-1299. doi: 10.1038/ng.239
[14]	Aguayo-Mazzucato C, Andle J, Lee TB Jr, Midha A, Talemal L, Chipashvili V, Hollister-Lock J, van Deursen J, Weir G, Bonner-Weir S. Acceleration of β cell aging determines diabetes and senolysis improves disease outcomes. Cell Metab, 2019, 30(1): 129-142.e4. doi: S1550-4131(19)30246-3 pmid: 31155496
[15]	Rezanejad H, Lock JH, Sullivan BA, Bonner-Weir S. Generation of pancreatic ductal organoids and whole-mount immunostaining of intact organoids. Curr Protoc Cell Biol, 2019, 83(1):e82.
[16]	Ho BX, Pek NMQ, Soh BS. Disease modeling using 3D organoids derived from human induced pluripotent stem cells. Int J Mol Sci, 2018, 19(4):936. doi: 10.3390/ijms19040936
[17]	Pan FC, Evans T, Chen SB. Modeling endodermal organ development and diseases using human pluripotent stem cell-derived organoids. J Mol Cell Biol, 2020, 12(8):580-592. doi: 10.1093/jmcb/mjaa031
[18]	Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo LQ. A global double-fluorescent Cre reporter mouse. Genesis, 2007, 45(9):593-605. doi: 10.1002/dvg.20335 pmid: 17868096
[19]	Kretzschmar K, Watt FM. Lineage tracing. Cell, 2012, 148(1-2):33-45 doi: 10.1016/j.cell.2012.01.002 pmid: 22265400
[20]	Hoffman RM. Recent advances on in vivo imaging with fluorescent proteins. Methods Cell Biol, 2008, 85:485-495.
[21]	Vintersten K, Monetti C, Gertsenstein M, Zhang PZ, Laszlo L, Biechele S, Nagy A. Mouse in red: red fluorescent protein expression in mouse ES cells, embryos, and adult animals. Genesis, 2004, 40(4):241-246. doi: 10.1002/gene.20095 pmid: 15593332
[22]	Megason SG, Fraser SE. Digitizing life at the level of the cell: high-performance laser-scanning microscopy and image analysis for in toto imaging of development. Mech Dev, 2003, 120(11):1407-1420. doi: 10.1016/j.mod.2003.07.005
[23]	Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y. 'Green mice' as a source of ubiquitous green cells. FEBS Lett, 1997, 407(3):313-319. doi: 10.1016/s0014-5793(97)00313-x pmid: 9175875
[24]	Snippert HJ, van der Flier LG, Sato T, van Es JH, van den Born M, Kroon-Veenboer C, Barker N, Klein AM, van Rheenen J, Simons BD, Clevers H. Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell, 2010, 143(1):134-144. doi: 10.1016/j.cell.2010.09.016 pmid: 20887898
[25]	Laugwitz KL, Moretti A, Lam J, Gruber P, Chen YH, Woodard S, Lin LZ, Cai CL, Lu MM, Reth M, Platoshyn O, Yuan JX, Evans S, Chien KR. Postnatal isl1 + cardioblasts enter fully differentiated cardiomyocyte lineages. Nature, 2005, 433(7026):647-653. doi: 10.1038/nature03215
[26]	Huch M, Bonfanti P, Boj SF, Sato T, Loomans CJM, van de Wetering M, Sojoodi M, Li VSW, Schuijers J, Gracanin A, Ringnalda F, Begthel H, Hamer K, Mulder J, van Es JH, de Koning E, Vries RG, Heimberg H, Clevers H. Unlimited in vitro expansion of adult bi-potent pancreas progenitors through the Lgr5/R-spondin axis. EMBO J, 2013, 32(20):2708-2721. doi: 10.1038/emboj.2013.204
[27]	Huch M, Dorrell C, Boj SF, van Es JH, Li VSW, van de Wetering M, Sato T, Hamer K, Sasaki N, Finegold MJ, Haft A, Vries RG, Grompe M, Clevers H. In vitro expansion of single Lgr5 + liver stem cells induced by Wnt-driven regeneration. Nature, 2013, 494(7436):247-250. doi: 10.1038/nature11826
[28]	Rodriguez UA, Socorro M, Criscimanna A, Martins CP, Mohamed N, Hu J, Prasadan K, Gittes GK, Esni F. Conversion of α-cells to β-cells in the postpartum mouse pancreas involves Lgr5 progeny. Diabetes, 2021, 70(7):1508-1518. doi: 10.2337/db20-1059 pmid: 33906911

Metrics

Comments

www.chinagene.cn
备案号：京ICP备09063187号

基因名称	引物序列(5′→3′)
GAPDH	F：CACGGCAAATTCAACGGCACAGTCAAGG
GAPDH	R：GTTCACACCCATCACAAACATGG
Cre	F：GCCTGCATTACCGGTCGATGC
Cre	R：TCCCACCGTCAGTACGTGAGATA
mTmG	F：CTCTGCTGCCTCCTGGCTTCT
	R1：CGAGGCGGATCACAAGCAATA
	R2：TCAATGGGCGGGGGTCGTT
Lgr5	F：CTGCTCTCTGCTCCCAGTCT
	R1：ATACCCCATCCCTTTTGAGC
	R2：GAACTTCAGGGTCAGCTTGC

Study on Lgr5 expression in pancreas tissues and organoids by lineage tracing

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 28

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	Shan He, Jian Zhao, Xiaofeng Song. Effects of N⁶-methyladenosine modification on the function of the female reproductive system [J]. Hereditas(Beijing), 2023, 45(6): 472-487.
[2]	Xiangyi Wei, Dongchun Hu, Zupeng Gao, Congjing Feng. JAK/STAT signaling pathway and its regulation on insect immunity [J]. Hereditas(Beijing), 2023, 45(3): 229-236.
[3]	Zhiyang Zeng, Jiawei Lu, Xiya Cao, Xinyue Wang, Dali Li. A method for constructing GLP-1 overexpression intestinal organoids [J]. Hereditas(Beijing), 2021, 43(7): 694-703.
[4]	Youhong Chen, Wenhao Yang, Chao Ni. Using esophagus organoid to explore the role of c-Myc in esophageal cancer initiation [J]. Hereditas(Beijing), 2021, 43(6): 601-614.
[5]	Xiaoyong Gu, Yang Liu, Lijing Liu. Progress on the biosynthesis and signal transduction of phytohormone salicylic acid [J]. Hereditas(Beijing), 2020, 42(9): 858-869.
[6]	Min Zhang, Lihong Liang, Yajie Lu, Xin Cao. G protein-coupled receptor-associated sorting proteins: function and relevant disorders [J]. Hereditas(Beijing), 2020, 42(8): 713-724.
[7]	Liping Zou, Cheng Pan, Mengxin Wang, Lin Cui, Baoyu Han. Progress on the mechanism of hormones regulating plant flower formation [J]. Hereditas(Beijing), 2020, 42(8): 739-751.
[8]	Haiqiang Chen, Huiyun Liu, Ke Wang, Shuangxi Zhang, Xingguo Ye. Development and innovation of haploid induction technologies in plants [J]. Hereditas(Beijing), 2020, 42(5): 466-482.
[9]	Lingqian Yin,Jinshan Ran,Jingjing Li,Peng Ren,Xianxian Zhang,Yiping Liu. Genetic regulation of broodiness in poultry [J]. Hereditas(Beijing), 2019, 41(5): 391-403.
[10]	Haoqiang Yu,Fuai Sun,Wenqi Feng,Fengzhong Lu,Wanchen Li,Fengling Fu. The BES1/BZR1 transcription factors regulate growth, development and stress resistance in plants [J]. Hereditas(Beijing), 2019, 41(3): 206-214.
[11]	Xiaomin Liu, Minglong Yuan. Progress in innate immunity-related genes in insects [J]. Hereditas(Beijing), 2018, 40(6): 451-466.
[12]	Qing Xia, Qiuyue Liu, Xiangyu Wang, Wenping Hu, Chunyan Li, Xiaoyun He, Mingxing Chu, Ran Di. The molecular mechanism of sheep seasonal breeding and artificial regulatory techniques for estrus and mating in anestrus [J]. Hereditas(Beijing), 2018, 40(5): 369-377.
[13]	Citao Liu, Wei Wang, Bigang Mao, Chengcai Chu. Cold stress tolerance in rice: physiological changes, molecular mechanism, and future prospects [J]. Hereditas(Beijing), 2018, 40(3): 171-185.
[14]	Yaping Liao,Chunjing Wang,Meng Liang,Xiaomei Hu,Qi Wu. Analysis of genetic characteristics and reproductive risks of balanced complex chromosome rearrangement carriers in China [J]. Hereditas(Beijing), 2017, 39(5): 396-412.
[15]	Qingyun Chen,Youzhi Li,Xianwei Fan. Molecule mechanism for regulating stomatal development in plants [J]. Hereditas(Beijing), 2017, 39(4): 302-312.